Description :
From Genome Similarity Track
Location :
contig_18:487573- 497115
Transcript NameFunction/comments
g3760.t1hypothetical protein

Sequence
9542 bases(100 bases per row)
CTACGTGTCGAGTTGAGTGAGCAGTGCGACGCCACGCCTAATCCAATGTTTCTGTCGGTGCTGTTCACTCATCGGCAGTCGGACGGACATGACGAAGTTC
GTGGAGTGGCCTGTGGTAGACAGCGTTCCCTGGCGCTTGGAAGTCTTGTACACCGGGCAGAGATACACATGTGCTGTCCCCTTGGGGTCCGTGTCTTCAA
TAGGCTCGATCTGGTCCCGAGCCTTGGGTAGTAGATGTAGAACCGGCAACGGCACGTACAGCTCGCGCGGCTTGGATTCAGCAAGTGAGTGCGAGTTGGC
GTCCCAGCATGCGCCTTCGAGGAAGAGTCCGTCGACGTAGGCTCCGTCCTCGGCTGGTATTGTGAGCTCTGATGCAGGTTGCGCCAGCACCACCATGTCG
TAGCCGACCTGGTCGATAGGGAGCTTGTGTTTTCGTGCGTAGTTCTGCTGGGTTCCGGTAATGAAAGCTTGTGTGAAGAAGAAGCCCGAGATCCAGTACA
CGGGCGGCGCAGCTCCACGCGTTAACCAGTTCTGCAGGAATGCCAACCGTGCCAAGAAGTCGGTGACCCAGCTGCCGAGCGGTTTGAGCGACGGGTACGC
CACCGCTGACCAGCGTGCAGGTACGTGGCCGTTTACCATACTATTGCCCATAGCTTCGAGCTCGGCAGACATGACCACCAGCCCCTTGATAGCCTTCTGA
ATTTCCACTAATGAGACTTGCAGCAGGGCCAACAACCGATTGAAGCGTCCGAGCTCCTGCGTCAGGACAGTGTTCATCGACTCCGAATAGCACACAGGGA
ATGCCAGTTCTGCTTTCTCGATATCAAACAGAGGGGGCAGCTTAGCCGCGATATCGCGCGCTGTTTCGTCCAGTACATCGTCCCAAGACTTGACTGCGCC
TCCTCCACCCCCAGAAGCACCACGTGGCTGCAATGACAAGGCCGATTCAAGCAGCAAATTCGTTTCGGCGATAGCGGTGGAGATGTTGGCGTTGTCGTGC
AAGCCGAAGACTTCCGGGCCTTCGTTCATGGGGAGCAGGTCGATATAGTTCAGGAAAACGGACAGGGGGCCCTCCGCCGATGGCGCGAAGTACAGACCCG
AAGGCGAGAAAGTATAGCTGTCCGAGAGGATATCGCGCGTGTAGAAGTCCGAGAGGATCGTGATAAGACACCTTCGATCCTTGTCGTCTGTCACACGGCC
GCCGTAGTTGCACTCGCCTGCAAGGTACGCCAACGCAGCGTACGGAATGGGGTCATCCGTCTGCAGATCATCCAGAGAAATCTTGAGTTGGTCTTTGGAG
ATGGCCAAATCCGACGAGGAGAACACGTAGCTGATGTTCCAGCCCAACGGCCCAAACTTCGTCCGCTCACGCACCACAGCGTGGAAGAAGCAGAGGCCAA
AGAGCAGCTTCTTGAACTCACGTGGCCGTCGGCAGCTAGCCACCCACCCTCGTCGATAGTCAAGTAGGACCCCTTGAGGTTTGCCCGCATACCCTTCGGA
GGCTCGTTGGTCATTTTCACTCCGTGCTGAAGAATGTACGACGGGAAGGCGCGTGTTGGCTCGCTTGTCAACCACAACCGGAAGCTCGCATGCACACGAT
CCGGTGTAATCTCTTCGCAAATCTTCTCAAGCGTAGGCAGCCAACTCACTGACAAGTGACAGTTCTGCAAGCACACCCACGTTCCGTTATCAATGGCCTC
AGCGATAGCGTTCTCAGCGAGAGGTCCCTGGCCCTGGCCCAGCGAAATGGCCACGAATTTCTTGTTGAACCCCAGCTCAGCAGCCAGCTTGAGCAGCTCC
GACATCGGGTCTGCCCCCGGCGTGAGCACGAAAATTAGCGGCGTTGAACAGTTCGAGTCGTCGAATCCCGCCTTCAGGTCAAACGGCTGCGGCTCAATGA
AGCGCTGCCCCATTTCGGTCGCCACGAAAGACATCACGGCCGGAATCACCTTGTCCGGTCTCAAGCAGCGCAGCACAATGATCCGCTGGAACGAATCCAG
CGAAGCCACGGAAGAGATGTCCATCAAAGTCTCCGCTGGATCGGTTGAGTTGTAAGACGCCTCCCAGAGCTCCAGATCACTCGCGAGCACATCGCTAAAA
TTTGTGAACGAAGGTAGCGCATCCAGCCCGACGATATTGGCCCACGTCTTATCATTGAGCCAGCCTTCGGAGCCTGAAGGCTTTGGCTTCTGCAAGTCCA
TCTGCGTGTTGCCCGTAAAGAAGTAGCGTAGCTCACCGCTGTCAATCGTGCCGTTCCCCACGAGGATCTTGATCGCCAACAAGAAAGCGAACAGCAGTTT
GTCCTTCTCGAAAAGAGAGCGACACACGTTTTGGTACAAAATGAACGTGAAGGCGTCGTTCAGATGGCCGAGCCGAGTTGCAAGGACAGACGCGCTCTCA
GCTCGGCCGATTGAGAACACGAAGAGGTTGATGAACCACTCGAGTGCGTATTGGTACATCGGGTCGATCACTGTGAGGTCGGCGATGCAGAAGAAAAGCT
GAGACGCTCGGAAGGCCACGGGCAAGTAGCCCTGGCGCTTTTCAGCGATCATCTGCTGCGTCACTGCAGCCTCACGAACCTTCTCCTCGATCTTGTTAGC
CGTGATTTTGGACGCACCGAGCGTCTCGATCAACCGTTCGTCATCCAGAATGTTACCCTTGGCAGTCTGGAGCAGATACAGGATTTGATCTTCGATCTCT
TTCAGTGTCTTCTTGTTAGCTGCATCCTCGAGCACCAACTTCTCCCGCTGCTGCTCCAGCACAGGCTCCTCCTTAGCAACTACGATTCCCAGCATCTGGT
CTTGCAGGCCTTCCTCGGTAGCCATGAAATTCAACAGATTGACCTTCACACAAGTCTCCGGCGGGTAGTGTGGGTTGCGCAGCTTGGTTGTCATGTACAG
GCGGAAGTTGGCGTCGTACTCCACAGTATTGTCACCCAGGCGAATAGTAGCCACCCCACCAGTCTTCACGACTTGCTTCAGTAGAACAGGCTCTAGCATC
GGGTCGATTTCTTCCGGCATATTCTCGATCAGCACAGCGGCGCCGATCATGATCGAGTTCTCCAGCATGCGCACGAACCCCGCTTGGGACTGCTTAACCA
CTTTGAGATTGTTGCTCTCCTCCATGTTCTTCACCCATCGGTTAGCCTGGCCTTGCGGGTCAATCATTAACGGCCACCGATTGCTACGCTGCAGCATGAT
AGCATTGTCAATCGAGAAGGAATCGTTCGGGAGCTTTGCAATCGTCCACGCGCGGATTTGGACGGCGTCGCCCAGCGTATCCGTGAGTGTAAACGTTTTC
GAGCACGTGATTGCCTGCTTGGTGAGCTCGGTACACCACTGATCCACAGCACGCTCACGGTAAATACTTGTAAACGCGCCAAGGTAGGCGATCACACCGG
AGGCCAGCATGATATCGCCCACGACATTGTCGTACAATCTGCAGTTGGGCAGACATATCACCCCAACGAGCTTTCTCGCCTCCCAGGCCACCGATAAGCT
GCGTAGCTCGCGTAAGTTTCTTGGAGCAGTCATCGACTTGGAACTCGAGGTCGCTCTTCTTCTTGTAAGCAGCAGCCAGGTCCTCTTCCAGCCTGGCCAC
CTTGTCAGCACCACCTGCAGTGCGTCTTGCTTGACTTTGAGCTCGCTTTGAGCCTTCTCAAGTGCTAAAGTAGCTGCCTTAAGTGCTTCACGCTTGGGCG
CCACCACCTTTGCTACTCGATCGTACAACCACCATAGCGTGCACCCAACTACAAAGACCCGAGGCTGCGACAGAGGCCTTACGGATCTTGTCGGCCTGGA
AGTCTGGATTCGCGGCGTATGGACGCACCTTATCCATCGCCTCCACTGGGATGTTGTCCTTGTCGTACTCCAACAAGTTCTGCAGAAAGCGGGTGTCGCC
TAGCAGCGATTTCTGCGCCGGTCCCCAGTAGTCATCCACCTTCTTCGTGCCCCCTGCTGGATCCTTCACCTTCACTGGGGGTACGCGCATCATGATGCAC
ACAGCTTCCATCACCAGCTTGACACCATCAGGAGGCTTCTTCATAGCCTTGATCTCGGTGATGTCGCCTTTCGTAAGAGTCTGCAGCGCCTTGACAGCGT
TCTCGAGCGCTGGAATGGCTTCTGCTAGCTCCGCCTCACAGCTTTCCTTGATACCATTGGCCTCAGCTGCTTGTTCGTTACACAGTTTTTCCTCAGCACC
AACGATGTCTTTCGTAACATTCGCCTCCTTCTGCTCACGTGAAATGGTCTCCAGCAACGCATCAGTCTCGATAGTGGCCACCTTCAAAAGCGGCTGCAGT
GCCTCCAGCTCGATCTGCATCTTCTCCACCTGCTCGGCCGTCTCCATGAGCTTCGTAAGTCCGTTATCATACCGCTGCTTCATAGTCACCTCGACGCGCT
TGTTATTCAGCAGCTTCTTGAACGTGTTGAGCAGCTCGAGATACGAAGTGGGGGTGACGTAGTAGTACCGACGCTGCGACTGTAAGAAGTCCTTCGTAAG
CGCGCTCACACTCTCCTGCATCCCAACGCACACGTCCACGATGCCAACCTTCACCTGAGCCGGCAGTTCAATGTCACCAGAAGTAGTCGGCCACGGAGCG
AAGTGCTTCGTCCGGCCACTCGGCAAACCAATCGATGGTACAGCAATTCACGAGAGACGGGAACATGCGCAGTCGGCGACGGAAAGCCTCTCCAATAGGC
GACAGCGCCAGCACAACATGCAAGTTGGTCCGACAACGACCCACAAAGAAATTGTACAGCTCGGCACTGTTTCCAGCATTAACCCTGAAGCTGTGGCCGC
AGGTTCCAGCGCCTCGTTCATCTGCACCAGTTCGTCATTGGCCCAAAGGTTTGCCACCTCGCCAGTGTTCAACAGTCCGTTGATGTCCTCCAGGTAGGCC
TCTTCCACGATCTGCGTGTCTGAAAACAGGAAGACCGTCGGCTGATTGTTCAGCCCGCTGAGTTGCAGCACCTTCTTGATATCGTTGCGCCATTCGGTTC
TCGAGTACGACTTGGAGATCTCAATCTGAAAGAGTTTGTACTCGGCCATGAACACGGCCAGAGTTGTAAGACTCTTGCGACCAGAGCCGCCGACGCCGAC
AAGCAAGGCATTCCCAGCGGCTGGTGAATCACGCGTGAAATACGCGCAACGTGCTCAATAGCGTTCTGGAACAGCACGAGCCGCATGGGTGCGGCACTCA
TGTTGTTGTAGTCTTCCAGGAACACCTGCATGGCATTCTGCAGCTTTTCGCGGTCACGGAGCTCGGCATAGCTCCTGTTGCCATGTTTGCCGTCACCTGC
TCCACCAAAGTTCCCGTAGATCAGCGTGGGGTTCGGGCCCCGCACATCCGTCGACGTGTATTGCAGGTCGAAGTGCAGCTTCACCGTTTTGGCAAGGATG
TCGGCAAACCAAGCGCGATCTTTATCGTCGATAAGGCGATCAGAGAACACTCGCAGACATTCGTGACTCCACAGACGCACAAAGTCCTTGCCATCCTTGA
TGGTGTCACTTGACGCCTGCGCGACGCCCTGGAAAACCTTGGACAAGTCGCGCAAGTTGAAAGTGTAGTGACTTGGCCGGAGTGGGCAGCAGAGCCTGCG
AGATCGTGTTGTAAATGTCGATTGTGGCACTAACGACTGCACCTCCGAGCTGCTTGACACCTTGCGAGAAGTTGAGCAAGAACCAGTCGGTGATCCGAGT
GAAGATGGCTCTGAGGGAATCGTTGTCGAACGGCACGAAGTTGATGAGGTTGAAATACCGCACATATCGCTGCGTGATGCGAGTGCGACCACCGCCAGGG
GGGCCCATTGCCGCGATAAACTGGATATCCACGAGCTGCGTGAACGAGTTGTCCTTGCGGTTGTACCAGCCTCCGTGACCCATCCACTGACGCAGGATCT
CGATCGGTGGCTGAGCACCGTACGTCTCTTTGGCAGGCATATTGAGGTCATCAACGAAAACCACGCAGCTTTGACCCAGTGGCGGGCCCAGCACACCCTT
GCGTCGTTTGTCTAGCTTGGCCTCAATCAGATCTTGAGTCTGGTTGGCACTTGTCTGCGCTGAGAAATTGAGGAATATGGACGGCGCAAACTTGGGTGCT
GCGTCACTGGTACCTGGCGGGTCATTCAGCCCGCTCAGTAGCTTCTTCTTGATAGACACGGACTTACCTGTGCCTGTATCACCAGTGCAGAGCACATGGA
AGTGGTGACGTATGAGGGTGTCTAGCAGCCACGCGTTGCGCTCGGAATCAATTGTAGGCACCAAAACTTGCGTGAATTGGGCGTCTCTGGGGATCACGAA
CGACCACCACCTGAAGCTTCCATCCAGTTGACCCAGACACTGCGTCGTGTATCAAAACGGTAGTCGTACACAAGTCCTTCTTCTGGGATCGACAGCATGG
CAGCTCGGTCAGGGAGGAGCACGTACGACGGAGATTTGGCAACGAAGTCTTTGAAGTAGAGTAAGGTGAGACTGGCACCCCCAATTCATCGTCACCCGCT
CCTCGCTTTCCTCCGTACGCACATCGGCAGTGACAATAGCCACTGCTAGCTCAGCTGAGAGGAAGTCGCGCATGTACCGGTCAAAACTGCGGCGCGACTT
GGTGTCGACGCAGGCGCCGATAGACCAAACGACAGCTTTGATGAGCACACACTCTAGAATACGCTGTGCATCGGCCTCAGCGGGCACAGACGAAGAGGAT
GCAGTGGGGGCAGTGCCGTCAGTTGGGGGGTCAGGGAAACCATCGCGGAGAGCGCACTCAAAAAGACGCAGTAGTGAGGCTGCGTGCTCCAGGAAAGTCA
CCGGTGTTGGCACCGTGCAGTGCTTGTCGACAAAGTACAGCATCGGCGGCACAATCCAGCGGAAGGATTCCTCGAGATACTCGCCATGAGACGCGAAAGC
CACAGGCAAACGAGTGTTCAGCCACGTCCGCACAAGAACCTCCCATCCCAGCACCTTTGCCTCGAGGAAAACCATGCCGACACGGGAGACCGTAGCAGGT
GATGCCTCTTCCAGATCTTCCGTCTCGAACACCATCCGCATACGGTCCGTCATCTTGACGATCTCCCCGCTCATGAGGCAAAGCTTCTTGTTGTCGTCTA
GCACGGTGTTCATATTCTCGATCCAGACGGCGTCCACTGGGCCATCGAACATGACCCACTGCAGCTCCGGACTTGTGTCGCGAGCACAATTACGATACGT
GCATGCCAGCACACCATCAGACCACTCGTGCGTGTTTTCATCAAAGTTCCCATAGAGCTGGCCGCTCGTGATAGCCTTCGGATTCATCGTGTGAATATTC
ACGCGCTGTTGCAACGTTGCAGCTCCTTTGGTGCCGTTTCCTTCCTGCAGCTCGATTTCTTCTTCGTAACACGATGTCATGGCCGTTGCCAGGGAGTGCA
CCACGCACGTCTTGCCTGAACCAGTCGTACCGACAATCATGAGGCCGTGTCGGACTTGCACCGTCTCGTAGAACTGCACCACCTTCATTTTGAATTCAGG
TTTGCACTCAAGCGGAACGTTCACATCCGGTACGATAGCTATGCCACGCACACAGGTCTCGTCGATATGGCGCAGAAGCGCCCCATGATCTGGAAGTGGC
AGCAGCACGTCGGGGAACAAGTCGGAAGTAATGCCGCGGAAAAGAGGCAAGTCGTCCGTGGTGAACTTGGGAAGATTCACGTCTTGTACAGAGCGCAGCA
CAATCTTGTCCTCCGTCCAGAACGGATCGTTGCCGAGCTGTTGTCGCAACGCACCGGTGGCCACGAGAATGGAGTTAACTGCTCGCATCCCGTAGTCGTA
GTGCTTCTGTGACGATAGCTGCTCCGAAGCTAACTGTAACACCTGTGTGAGCTTGCGAGCGTTGCTCCGAGCCTGAGAGAAACCAAAGGAATACAGTCGA
ATTTCAGAGATCAGCGCGTAGTCGGGCACCATCATAGCGCACGGACGGAACAACGCCTTGAGGTTGTCAGGTAGCTCAGCACGCCCTGCATAACCAGGAT
TCATCGTGATGAACACGTTGGCGCTAGCATTGAGCTTGATGAAGGTCCCTTCAAACAGGAATTTGTCCACGCCCGCCTTCTTGCCCTCGTTAATCGTCAG
AATCTGCTGAGCAATGACGGACAGCACCTCGATGTTGATTCGATTGAATTCATCAAAGCAACACCAGGAGCCACAGCCGGCCAACCCCTTGAAGAACTTT
GCCATAGCAAGGTAGTCCAGACCATCGGAGCAGTTAAACACCACGCACTGAATGGCGATCGCTTTACTCAGGTCCTTCACGGTCTCCGTTTTGCCGGTGC
CTGCGGGCCCCTCAGGCGCACCACCATACATCAAATCCACAGCTCCCATCATTGTACGATAACACCTATCTGTAAGCGGTGTGATCACAAGACGCATCGT
GTTTCCGAGATATTCGTATCCGTACCGGACTCGGGCATTCACAATCCGCGCTTGCAAGTCAAACGCACCAGCAGATTTGACACCGTCCGCCCAGTAGTAC
CGTAGCTGAGAGATCCACTCGAAATCCTGGTCGCTTTCCACGTCCTTCTCGATCATGTGAGAGATCGTGTCGCGTGCGTGGACATCAATTACCACCAGCG
CACTAATTGTCGTACGCTCCAGCTTGGTCAGATTGCCGCGTACCAGCATCACAATCTTGTCCAGTTGCGAGTTAAGCACCTCGATGTAAGTTTTGATTCC
ATTTACACCGTTCCCGAGGTTAAGCGCTCGGGTAACATCCTGCGTCCAGTAGACCTGTGATACTGCCAACACAACTTGTGCAGGCCACTTGAGCATCCAG
GATTCGCGCTCTTCAAGCAGATAAGCTGCAAGAGAACGCTCAGTTTGATCTCGCACGCTGTCCCACTGACTCTGCTCCACCTCGAGCAGCCACATCTCCA
CGTTGCCTTTGTTCTTATTGCTTTCTGGGCCCACGGGCAGTCGCAAGGGCACGACTTCACCTTCTGCCGACCGCATTTCAGTAATTAACAGGGGGGTCCG
TCTTGGAACGTCACGTTGAACACGCCCTCGAAGCACTTGCCCAAATGTGGCTGCACTGCACGCGGTTCCTTGGTCTGCGACAGAATTTCTAGCAGCTCGT
CGTTCGACAAGAAGAAAAAGCGTGGGAAGTGCAGTCGCTTCATCTCGAGATAGTCGTTCAGACCCTTTTGAATCTCGTCCAGCTTCTCGTTGGCACGCTG
GAACTTCGCTAGCAGCTTATCCATTGCGATAACAGTAAGAAAGGTTGGGTCGGCTACCGTGTCCTCCATTGTTTTGCGCCACAGCGCATCCACGCTAGCA
AAGCGACGCGCCTCCGTTGGCATTTGACGCATAATGTCCTCAGAACTGAAAATTGCTTCGAGATACAGCCACGTACGTTGACATGCCATCCACTCGTCCA
GCAATTGCTGCGAGTACTGCAACTTCTTCTCCCATGCCTTGCAGTCTTTCTCGATGCTCTTGATATACGGAGACCCACGCATCGTTTGCGTCTTCACGAG
GTGGTCGTCCAGTAGTGCCACAATATCGTCGGTACTGCGTAG