Description :
From Genome Similarity Track
Location :
Scaffold_1578:4875- 6325
Sequence
1450 bases(100 bases per row)
GTTTACAGTGcaccgttggagatgctcttagGTACCCACTGTATTCAAATCAAACCGCCCCTAAACGTCCTTTAACGCAGAACCAGATCTCCACAAAAGG
TGCAGCAGTGTATTACACAGCATTCCGTGGAATTTGTGGAGCATACCTGCCGCTACACTCACGCCCCTAGCActtcctgctcttcaacAGCGTCTACATT
GGTCACTCCAGGAAGAAGGAGAGACGCCTGTAATTGCTGCTAGCACTTGGAGCCCGACGGGGGCCCCAGCTTTTCACATGACCAAGAGCAGTGATGGTTG
GACTTGGAAAACAGCATGGATAGACGGAGAATATCAAACCAGTGCAGACTACCGAGAGCTCCAAGCCTGGGAACGAGCAGTACGCATCAGCTTTGCGGTC
AACCCCCAAGTTAGCTTGTACCCGTGGAAGACTCACCCCAAGACCTCAGCCCTCCACATTGCGCAGGCGAAAACAACGCACAAAACGATCGAAACTACAC
AGCAACTACAAACTGACCCGAATGATCGAGAAGATTAAATCAAGGGCCAATTCATCATTGTGGGGGCAAGCTGCACTGCAACAAAGCCCGGCTCAACTCT
GGAACCGTGACGGATTATACACAGACTATCTGAACTGGACGATTTACAGGGTAACCTTGGCGTTCTCAACTTGAGACACGAGGGATGGCCACAAAATCGA
CAGTGCCCTGACCCGCAATGCACGTGCCCCGAGGAAACGATAGACCACATCATCTGGAACTGCGCAAAAGCGCAAACGGCTTGGTCATCATGGATCAGCC
CTTGGATGGGAGAGCAGTGCTCCGACATCCAATTGCATCATCTCCGGTCAGCGTTAGCCAGCCGAATAGCTCCGCTGACATCGATAGCATTCTTGTCAAT
CGCACAGCAGTGCGTAGGCAGATGGACATACCAGCACACAGCAGCGATGAACTTACTCTGGCAAATATGGTGTACTACAACTCCTGCAATGCTATGGAGA
CTTCGGAATGATGCGGTGTTCAACAACAAAATCAGCAACGAAGAAGTAACAAAATCAGCACTACAAACCGTTGGAAACCACCAAGTAAAAGCAATCGCTA
GTGCCTGGAAGAGGAACCCAGTCAAACGCATCCAAGGACTGTGTCTCGACACATGCCAACAGATCATGAATACTGCCCGGAACACACCACCTACCAATAT
CACGGCATGGATACTGGATAGTGTCTATAAGGCAAATGAACACGGAGTCTGGAGCGGAGGATGGGTTCTATACGCCCACACAAGTGATAGTACCTGGAAA
GCTGTACGAGTCGGAAGCATGTGTTTAGCTACATAAGACAACCTACACAAAGTGGCAGCACAGGTGATTCATCAAGGAATCAAAAGGCTAGCAGAGGAGA
CAGCATTGCAGCGGGTCTTCCTGCGCATCAACGCTCTGGACATCAAAATC