Description :
From Genome Similarity Track
Location :
Scaffold_36:4875- 18385
Transcript NameFunction/comments
Phyag_g916hypothetical protein
Phyag_g917hypothetical protein
Phyag_g918hypothetical protein PHYSODRAFT_509937
Phyag_g919G-protein beta subunit
Phyag_g920hypothetical protein PHYSODRAFT_340865
Phyag_g921crinkler (CRN) family protein, putative

Sequence
13510 bases(100 bases per row)
AACCCCAAGTTCCCGCTGGGTTCGGCTCTGGAATGGGCGTATCAAACGCCTTATCAGTTCCGAGCAAACGCTATGCGCATGTTTGATAGCGCTGTGAAGT
CTGCGTTCACCAACAAGGCCGCGAACAACACTACACACTTCAATATGAAGTTTGCGTCGAAGAAAACACACCGGTACTTCCCGATTCAAGCACTACAGAG
AAATACGTCTATCAAGTCACGCACGGACGCATCGGGGAACACCAAGCACTTCCTGCCCATTGCAGGAGTAAAAGACATCCGCATGGTCGCCGATGAGTTG
CCGGTGATAGGTGGTTCAGCGAACATCACGGTGGGTGGTACGCCGTGATCCCGTCGCAAGTGGACGAAATCAATTCGGCGACAGCACTCGACCCCGGCGT
CAGGTGCTTCTTGACGGGGACGGATATGGAGGGCAACATCTGTGAGATTGCGCCGGGcacgcaggagaagctcgatcGGTTCCGAAAGCGGATCGCAGAT
GCTCAACGTGTGATCTCCAGGTTCAAGAGCAGACGAAAACATAGGTACAGGAACTATAGAACTTACGTGAGAGCCAAGCGTGAGTTCGCCTGTGCCACCG
CTTGTCAGAACAATGTTATTAAGGACCTTCACCGTAAGGCGTGCTACTACCTCGTGAACCGCTATGACACTATCATCTTGCCCAAGTTCAGCACCTCGGA
GCtactgcgcagcagcaaggcgcAAAACCACAAGTTCAACGAGCACCTATTGTCGCTGAagcacttccagttccgggagctgctgcgtacCAAGTGCGTG
CGCCCGGGGACGGCACTGATCATCTGCTCCGAGATGTACACCAGCAAGACCCGCGAGCGCTGTAACAGTCTGCACCTGACGCTAGGGAGCAACCCCGTGT
TCAAGTGCCCCCACTGCGAGCCCACCGCCAGTCGCAACGCGAACGCGGCTTACAACATCCTCCGGTTCGTCTGCGCCGGttcgctggagatcaagcagga
gggagcaggaggaggtcgGACTATCGCGGCCCGCCCACAATGTGGGTCTTGGCGAGGTGGCGGACACTCGTCCGCTGTTAAGCTCAAAAGCTGTCTGTCG
GATTTGGATTTGGAAAGTAGCTTACGGTGGTATATGTGTTGGAAGTCTCTTAAAGCTCTTTACGCGTTTTACTGAGGTGTTGAGTCATCTATGAATCGCC
CTGTAGGTCGTAGCAGTAGTGTTGGAAGTCTCTGAAGCACTTGTCGGACGTCTAGCATCATGTCGTCGTGAGTCAGCAGCTCCCGTGATCTCAGACCTGA
CACTGCCACGAGGATGTTCGAGACTTCTTGCTCGGTcatcgctgcgtctgcagtgTGGAGACACGTTTGGAGGTCGTGCAACGAGATCATCAGAGCTCCA
GCATCCTCTAATTTTTCATCGATCTCCGAGTCGTTTGCATTCGGTTGCACATGCCGTCGAATttgtcgctggacgtggtggcggaAGGTCAACAGGTCAT
CCATGCGTTGCATTCTCAGACACTCAGCAAATTGCCACTTGACTTGAGGCCGAGTTGCACCTTCAGGCTTTGCTTTTAAACTTTGACTGGAACCAACGGG
GTGGTGTGCCAGCAATGCAGTATAATCAACCTGTGGCTGGCCTCGTAGATCTACCAGCAGAGTACGATGTAGTTGGCTCAATGCTGAGTCAGATTTCCAA
GGAAACACAAGTCGTAGAGTCCGAATGACATCGGACTGCAAAACTCGACCTGGAGGAAGTGGAATGATACTCGGGTCTCCCGATTCACAGTCTGACGACG
TGTTCCGATCACGATCCACCACGACGAGAGCCTCATGAAGTCTTGCTAGTTCTCGGGCTTGATCACTACGAGCGTCGATGGGGAGTTCTTGATTGTATAC
GAGGTGGAACAATCTACAGGCACTAGACTGCGCACTGAAGCGCTCTAGACCATCCAGGAAATTGTACACGAACTCGATTCGGTCCGCTCGATTGTCTCGA
GAGCGTTGAACGAATCGTTCAATCACCATAGCGAGCAACGACGACCCCATAGCCGAAGCCCGCGTGGTAATTGATGTTTCATTGCCTGAAACCATCGACG
TTCGAGTGAAGGAGTGTCTGTGTTGAGTTACCCTCAACTGCTCATCGAGTTGATCCCATACCTGAGCAACAAACTGCTCGACCTTCACGCGTGAAAAGAA
GAGGTTTCGAACAAAGCCATCGTGCTGTAAGTAACCAGGGACATCCGAGCTCATCCCTCGACCAACGAAAAAATCTCCGCTCGCCTTTGGCTGCTCAATC
GAAGACGTGACGAGTATTTCAGCGATGGTCCCGTTCAATTCGACCAGCTCGGTTGGTTCAGTGAGGAATACAACAGGACTTTGAACATCTTTGTCCGCTT
CTCCCTTAGCGGCGAGCAAAACgaaatgctgttgctgaacttgTCGTAGTCGCTGTGTAATGGCTGTAGCCGTGGCGTTGATACCGTCAGGGATGGTGGG
TGAAGTTGTGGTGCGATCCAAGAGCTCCGAAAGCTCTAGTTTGAGACCAAAGGCATCCAACCCCGTCACAAACGCGTGGTTCAGGGCAATATGCTTGTCC
TCGTTACCTTCTCGATTTGCATGTGAAAAATTGTtagctgtcgttgttgcagTTAGAGCCGTAGTCAGTTCTTGAAGCTCGCGGCTGAGTAAGATGATAG
TGTTCTTGTCCGCCGCAATATGTTCTCCATTCCCTTGCTCCTCCAGAGCTGCTACCGTCTTCTTAAGCTCGGCAAGCTCGTCGCAAGCGTGATAGTACCT
AGCCGTAACCTTCTGCAGTGCTCTGGCATCTTCCAGTGATCGTTCATGACCAGCTCGTAGACTTTCGTCATGTCTTCGTACGCTACTAGCTAGTGCCAAT
GTCGACCGCTGCACCTCCGCAAGCTTGTTTTCCGCCTGAGTGACATTTTCCTTCTCAGCCTTTAACGCAGCATTGAGCCGAGCATTTTCTGCTGCACTAG
CCGCAAGCATCGCCTGAGTCTCTGCTAATCGGCGCTTCAGTGTCAGCGAACGAGCTTTTGCTTCGGCACTGCAAGCACTGAGCTGTTGAAGACAATGGGT
CTCCACACTCTGCAGTCGGGTGTGCAGTCCTGGCACCATCAAACTCCGAGCATGTAAAGCTTCCACTGCATGCTCATATTCATCTCGGATTCGCATCAGC
ACTGGCGCATACACACTAAACCCATCGATGAGTTTGCCCAGCGCTTCTCGAACGACTTGGAGTCTTCGTAAACTTGGTTGAGTAGAAGTACCAGTCGAAT
CCTCtctttcaccaccaccatctaACTCGACATGTAGGAAATCAagcaattcctgcagcaacgccgGTCGAGTTCGACTGTCGTCTACGAGACGTGTTCG
GGCGTGAAGCTTATGCACCTTTGGGGAGATCGGTGAAAACGGATCAAGATCGACCATCGAGTCGGTCTGCATCCGTTTTGTGGGGCTTCCAGATGCAAAT
GTTAATGGCCAAGACGcaacttgagctgctcgttgttgGTGATGGTGTGGTTTGTCTAGGTGGAAATAATTTACTGTCGCTGGCGACCTCGGTGATGGTG
AAGCCAATTCATTGAGAATACGTCTTGGAGATTGAGAAGCGATGGTGAATTCAGTGGACGCTGGTTGTAAAGGCGGTAGCGATGCGTTGGTACTTGTGGA
AGTTTTCGACTGTGTCAGacgtcgaggtggtggactGGCAAGACCGACTGAGACGAAATCCATGCTGCTACGTACTAAAAGCGTTGGAAGACTCCCATAA
TGAGCAGTCGGGAACAAAGAGGGACAAACGGTTACTGAGTTAgtggcgctgcgtcttgTTTAGACTTCGATACTATGGGCAACACATTCAGCCTCGATGT
GTCTGATCCTTTTGTGAGCGATGACCCCCTGCTCAAGGTAACACGTGTGGCCAACTCTGGTGGTAGTCTTTTGTGCCTAAGCGAAAGTTGTAATGCCGAC
TTGCTTGTCGATGTGATGATTTTAGGAATATAGAGCAGGTTAGTAGGAGAAGTGTCCTGGTGTAAACGAGAAGATTAAGTTGTTTACTTTTTTGTGCGTG
TTAGCGACAATCGACGACTTTAGGGATGCAAAAGAGATCTTTGACACATTGCAAGTGACTGTGGGCGACAAAATGACCGTCACCCCAGAAGAATTTGACG
AGATCTTCTCGCTAGTATACCAAGATCCAATGGAACACTTCGCACTCTTTGACTCGTGGGAAATTGGCAAGGTGGTCTGGCACGAGCTCTTCTACATTTT
CCCTATCTTCAAATATTTATGGAATTGGTTCCTCGTTGTTGATTCAGGTGGATACTATGGAGGTTTTCGCTGTGATCATTGTGTATTGTGATGCGACGAT
GGAAGAAAAAGTTCCTTTGCTGTTTAATCTCTTCGACTTTAACCACTCCAAGGAGATTTCGCAAGACGAATTGGTGCTTTTGATGCTTTGCACGACTCGA
GGATTGTGCAAAGTGATCGGGATGCCCAGACCAGCAACAGACAGTCTTGAGGCTCTCGCCACCGACGCTTTCTCCCACATTGACCAAGATCGGAGTGGTC
AAATTTCGCTTGATGAATTTTCTGAGTGGATTCTGCACGAGCGTAGTGTGATGTCATATTTTGCAAAGTTTGCCAACATGCGGGTGATTTATGACAACCA
GGTGCAATACGACCTGATTCTAAAGGAAATCTGTACGGCCTTCATGAATTTTTCCGAGGTTGACGCTACCGACAGTGGTGACCGAGGACATCAAGCTATG
CTATGTTCTGAGGACTTCTGTGAGGAGATGATTCAACGCTACTGCCATGCACCTGAGAAGAACGAAATTGAGTTTTTGCTGCGCACAATGAAGAGAATTA
TGAAGAAACAGAACGGTACCAatctggaagaagacgagacCTACAAATCTGAAGACTTTGCAACAACCCCCACCGACAAGACGAGTGGAATGATCTCTAT
GAATGCATTTTTCCTTGTTATCTCACCGTACGCTGCATTTCTCGCAGCTGATGACGGTAGAGAACACTCGATCAACGTCAAGGAATTGAAGACCCTGATC
TGGCTGCTACGCGGCTCGGAACCAAGACCAACAGTGGTAGACAGCTTCATGAAATCGTTGGACTGCAATCACGATGGCTTACTCAGTGCGATGGAGTGGG
TCTCGTACGCGCTCGAAACTAATGCGCAGAACGGGAGTCAATCGTTCGCGAACCAAGTTCATCTGCTCTTCGCGACGTCCGACTTAAACGGAGATGCCAT
GCTATCGTTACCAGAACTGGAAGCTGGTCTTACCTCCATCTTCGCTGATTATTTAGATCGCGTGAAATTACCTCCGAAACCAGtggcttcagcagcttct
cccgAATCGGCATGGGAGGAACTCACAACTCCAGAACGCGTCGAAAGACACCACGAGGTGCAGTTTTCATCGATCAAGAATCTTGTTGCGGAGCTAGCCA
GGGAAATCATTCAGGAAATGGACGTAAGCGAGTCCCAGCGCATCGAGTGGTACGAGTTCCGCCAGCATCTCGATTATCTCGAAGTACGTGTCATGGAAAC
GAAGACCTATATTCAAGAACACGTGCTAGACCCGTAGTTGTCGGTTGCAGTTCTGCTTCTAGAAGAACAGGACAATTAAGAATCAAACGCGTAAAGTGTA
AGGAACCTGATATAAATGTTGTAgctcttgctcctgctgctcttgttggTTTGCACAAGGTTGTCAATGACGCCTCCTACCTCGTGCAGCACCGACTTCG
TTCGTCTTGTTGCCACGGCGTTAAGCATCTACGCCCAGATCTTGAGTAGCGTGTCCCAGCTGCCTGTGCACAGTGCTTGCCCTGCCGGGTTGACCCCAAG
GCAAGATACGCGGTTCTCGTGGCCCGCAAGCTGGTAAATGTGCGCTCCTGTAGTGCTCAACACGTCCCAGCAGTAGCAGTTGTAGTCGTCATATCCCGCA
AAGAGGAAACGGCCCgacttggagaagctcaCGGACGTGATACCGCACAAGATCTTGtcgttgctgaagttgttaAGCTCGCCATACGCGCGCAAGTCAA
AGAGACGACAGCTCGAGTCATCAGACCCAGTACCCAGAGCGTTGCCACTTGGGAAAAAGTCGACCGAGTTGATATCCGACTCGTGACCCTGGAACGTGTG
CGTGGTTTTCTCCGTGCGGATATCCCAGACTTTGGCCGTCGAGTCGCACGAGCCGGAAATGAATATGCTCGGGTTGTGCGGGTTGATGCTCACGGACATG
ACGTCGCCCGAGTGTTCGCGGAATGTGGTCTTGACCTCACCACTCTCGACGTCCCAGAGGATGCAGTTGGAGTCCCCCGAGCtggtgacgatgctggcct
cgtcgatgaacctgcagcagctgaggtAGCCATCGTGGGCGGCGAGTTCCTTGGTGGCTCGCATGACCTGCGCCTGCGATAGgtggaagatgctgcagag
gTTGTCGAGACCACCACAGGCTACCATGTTGCGCTGTTTCTGCTCGAAGGCGCATGTCATGACCCAACTGGAGCGCAGTGGGATTGCCTGGATTTTATTG
GTCGTCTGGGCGTTCCACACAATGAGTTTGCCGTCCTGGGAAGCGGAGACCAAGCTCGAACTGTCGCCACCCCACTGCATGGCGTAGATCTTGCCGAAAT
GGCCTTTCAGTAGTCTTCTGCACTTGGGCGGGGCCGGGATCGGCTTGGCACCGGAGCTGGCATTGGCGCTTTGGAAACCTCCGTCGGATTTGGCTTCGCG
CGTCTTCTCGATCGTCTCTTTCAGACTTTcgcacttcttcttgaggtcaGCGGCTTCGGCCATGACTGTGAAATTAGCGATGACAGGCTACAGGTATCGG
GTGTGAGCGGGGGATAGCTCAAAAGATAGAGGAGAGCgtgacgaagagctccgaGAAGTTTGGCGCCTCGAGGATGGCGAGGAGACGCAGGGCGAGGAAT
GCCGCGGGACGTGCACGGCCACAGCGACTGTTCGAAGTATTTATATAATAACTGCCTGCCTCTTCGCACCGTTTCGCCGTTTTAGAAAAAATCTTCCATG
GAATGGACGTATTTGATTGGGCGGAAAgatgttgatgttgaagtggaccacaacatggctacatgctactactactactactgaagttgaagctgttgtg
TATCACTGGGTATCGTAGCCCTATGAAGAAGCCGTCTCCACCAATTTCGCGTAGATTCCACGCCGACTGACAAGCTCCTGATGCGTGCCTTGCTCCGCAA
TCTTGCCACCATTCACCACGCAGATCTTGTCCGCATGTCGGATCGTGGACAGCCGGTGAGCGATGATGATGGTCGTGCGCCGCTGCATCGCTACTACCTT
GTCCAGTGCCTCTTGCACAATTTTCTCGCTCTCCAAATCTAGTGCGCTTGTGGcctcgtcgagcagcagaatgctGGGATTCTTCAGCATCGCACGAGCG
ATTGCTATGCGTTGCTTCTGACCTCCCGATAGCTGCTCACCTTTCATCCCAACTTGCGTTTCGTAACCATCGGGGAATTGTGTGATGAAATCGTGCGCAT
TTGCCATCTTCGCCACCGCTTCAATCTCTTCCAAGCTTGGCATTTCATCCAAACCGTACGCGATGTTCTCCGCAATTGTGCCGATAAACAGCGTTGGCTC
TTGTCCCACGAGGCCGAGCTGACCGCGCAGCCACCGGACGTTCACCTGCTTCAAATCCACTCCATCCAGTAGCACTTGGCCGCGAATGGGATCGTAGAAC
CGCTCCAGTAGAGCGACACACGTGCTCTTACCTCCTCCGCTCGGGCCGCAAAACGCCACCGTCTCGCCGGGCTCGATGGTGAGGTTATAGTTTTTCAGCA
CTGTCACTTCAGGTCTTGTCGGGTAGCGGAAGAGGATATCCTTGAACTCAATCTTGCCCTCCACACTTGCTGGTCGTAGACCGCCCTCGTGAAAGGAATC
AATGGGTAGCCACCGGTCTCGGAGCGAAAGAATAACACTTCCCGCCTCAAATGCGCTATCTGCATCCGCTATATATCCCACAGAGGCCCCCACCGTTTGC
GACGACATGATGATAGCCATCAGCGAACGCATTAACTGCAAAAACGTGATTGAGCCGTCGTTGACCAGCTTCCCGCCGTACCAGAATACAAACGCGTACG
tagcgaagacgatgaaggaaCTGAAGCCGACAGCTAGACCGTTCACTTGTGCATCGTGCTCACCACTTTTCATGGGCTCGTCAAGCAGTGTCATAAACTT
TTCGCACGAAGATCTCTCCAGCCCGAGCGACACAACAGTGCGGATGTTTCCGAGGACTTCTGATGCGTGCGCACCAACATCAGCCATATCATCAGCGAGA
ATACTGCTACCACGTGTGTTCATTGATCGAAACACGTTCCCAAGAACCAGGAAGGGGATGATGGCGAGCATTACGAGCGTAAGAAGCCAACTTCCAGCCA
GGAATGATATCAGTaatgccgctgctgtcgtgaAGATGGCTTGGAAAAGGCGACCTTGAGATTCACCGGATATCACGGCAACACGAAGGGCGTCCGTCGC
AAGATCAGCAGTGAGTGCTCCACTTGCATGCTCCTTTTCGTCGAAGAACGCAACGTTCTGTCTGCACAGGGACGAGAAATGAATCCCACGAAGTCGCGCA
GTCAATTTCTCCGCCATATACTGAAACCCATAGCTCTGACACGCTCGTCCGATCCATATTACCATTGCCCCAGCGATGTAGAGGCATCCGTACACAGTCA
CCTTGTGAGGCAAGCTTGACAAGTATGACGCATCGTCATAAGCCTCGTAGTTGGCATAATCCAGCGTCATTATCGACACCAATTGACTGATGAGaacagc
agaagctggaaaCGAGGCGCCGTTAATTGCCGACCCAACCATACCCATGATGAAATATCCGCGCTCTGGTCTGCTGAGAGCGTTGGCATCCCACACTGTA
AACTTGTGAGAAGTCTCACCATCCGTTGCTGAGTCATTCATGCCAGCAGCGCTAGAATGGCCGCTGTTCCTCGATCCATCACTTCTCACAGAACGACTGC
TTCCTTGCCGAGCCAGGTCTGGTTTGACCTTTTGGTGGATGCGCTCTCGCTCAGCATCAACAAGAgccaaagcagcagcttcagcttcttcttgcgcctT
TGCTTCTTGAATCGTGTACAAGCCACGGTAGACGCCatgctcgagctcgacgagctcatcATGGGGGCCTTCCTCAACAACGTGACCTTCAGTCAGTACA
ACGATTTTATCAGCATGGCGAATCGTACTCAGTCGGTGAGCGATAGCCAACGTCGTCATGTTCGTTTTTGCCATTAGGTCGTTCAACGCATTTTGCACGA
CCCTCTCGCTCTCGGCATCCAAAGCGCTAGTAGCCTCATCCAATACCAGGATCTTCGGTTCACGGATAATTGCGCGTGCAATCGCCACACGCTGTTTTTG
GCCTCCAGACAACGAAACACCTTTCTCGCCGACCAGGGTATCATAGTTCTGGGGAAGCGACATGATGAACGTATGAGCGTTGGCCAttttagcagcagca
ataacgtCATCCCGAGTGGAATCAGAACACCCTGCAGCAATGTTCTCGAAGATTGTGGTAGCGAACAATACGGGTTCCTGGGAAACTAATCCAATCTGAG
AACGCAGCCATTTCACGTTAAGAGTTCTCACATCTCGTCCATCCAAGCGAATTGAACCACTGGTAGGATCATAAAATCTCTCCAGCAGTGAAATGATGGT
GCTCTttcctccaccacttgcACCAACAAAAGCGACAGTCTCGCCGCTTTCAATGGTGACGCTGTAGTCTCTCAAAATCGGGGCTTCAGGTCGGTTCGGA
TAAGCAAAATTGACGTTGATCACCTCAATCCGACCGGAACACGAACCGGGAACAATgccttgctcttcttgaGACGCATCAATTTGAGATTGCGTGTCCA
GGAGCTCGTAAagtgcaactgcagcgcccTTAGCTTCGATAACAGCGGTGAGATTTGGCGAGATCAGACCAAGCGCTCGCATACCCATGAGAATCCCCAT
GAGTGATTGAAAAACGCGTTGCGGAGATGCCTCTCCTCTCCACACTTTGGAGCCTCCGTACCACAATCCAGCGGCATACATGAGCCAGTCGCATCCACGA
AACAGCCCCAACATAAGTGCAAGCACTCTGCTTTGCTTGATGTTTTCCTTCTCAACCTCAGCAGTGTGCTTGTTGTACTTTGCAAGAGCGCGTTTCTCCG
CTGTCAGTGAGCTCACAGTTCGAATGGAGCCCAGAGTTTCTTCCGCCACAGCCCCCGCCTCAGCATATACTTGCTGCGCACGGGTCGCTCTCGAACGCCA
TCTTTTCAACACGTAAGTCATCGACCAGCCCATCACTGGTATGATGCACGTCATGACTAAAGCGATATCCCATCCACGCGCTAATCCAATGATGTAACCG
GTCACAAACTGGCACACGTACTTGACTCCATCACCCAGCTTCTGCCCCATGCCGTCCTTGATCTTGACTGTGTCGCCCGTGATCCGACTCGATAATTGAA
GTGGATCATGAAGATCGTACCACGAGATATCCATATACAGCATGTGCTGCAACGCGTGAGCTCGCAGTGCCTTCATCTGCCGTTCAGCTGAAAGGGAGAA
AAGCAGGTACGCAAAGTAATCCGTCACGAAGAGCCCAATGGCGATGAGAAAGTAGTCAAGCGATGCGCTGTTCAGTGTTTCGCGATCAACACCGCCGTCT
ACCGAGGCAAATGCCCCGATTGCTTTGCCGAATACCAACGCAATGCACGGGAAGAGAGCGCCGTTGATAGCTGCCATGGCCACACCCAGCATCAATAAAA
CGCGGTCGGAGAATGTCGCGAAGCGATAGAGATCCAggaacgagaacgaggacggcgagttTTGCGCGTAGTTCCTTGTGTCATTCTTCACGTTAGTCGG
GTCCTTTATTAGCAGAGTTACACTGCGCTCGCTAGTGGAGTTGCTGGCAGCGGCACGTGGAGTCACCAACTGTGCGAACGGCACGTCGCTGGAATTTGAC
TTAtcagttgaagttgccatgAGACTTTAGTGTGTGGTGCGTGGCAAATAACCGAGTGGGAATGGAAGAAAGCCTGGTGAATTTCGCCAGTATTGGTGCT
GCGCTTTGCACAGCGATGTGTGACATTGGCCAGCGACAGATACTTTTGTGTTTGTCAGAGATTCCACTGGCTGAAAAGTGCACGGATTATCATGCAAGCA
CCCCGCAGACGCGATTACGTCAGGTCCTGTTTGAGACGGGCCGCAACTCCTTTGAGGCATCCGTTTAGGACTATCATTTTGGTGTCGACAAGCAATGGCC
GCAGGTTTCTGGCGGCCATGAACATTGCGACCCACAGAACGCAGGCGATAGAATTCAAACGGGTCGGGTCTTTTTGCTTTACAATTTCGGCGTGACAGCC
TTGTTCATGCCAGCCTGGCATTAGGGCGCTTTCGAACAATCTTCAACGGGTCGTAGCAGCACACCATAAAGTCCtctggaggtggagcatCGATCAAAGT
TAACCTTTTGCATGTATTGGCGTCAGGCCCCACGACCACAAAGACGCGAGGGATACTTCTGGCAATGTTACCATTGGCATCGAGAGCCTTCGTCAATTTC
TTCCAGAGCCCCGGCCTGAACGCTTTCACATCAGACACAGTGGTGCTGATAACGGCCACGATCATTTCCTTCATGTTGGTCCCCCTCAAGACTGCTTcga
acagcaccaccgcgTCGATAAAAGGAAAGTTCACGCTGTCGGGATGCCAATATGCTCCTGAAGATACTTTTGGCAAATGTTCGTGGCACTGTTCCTCTGT
ACTGCCCTCGCATCCAACAGGTCGTCCGTGCAACTCGAGTCGGTCATATCTCTGGTTTGAACACGACGGGTCTGAGTTAACCACAACGTTTACGATCCGA
ACAGGAGACCTCTTCGTTGAGCGACGAATTGCACCATGAAAGCACTGCTTGTAGGCTGAAGCCCAAAATCCTTCTCGGAGCTTTTGCGCGAACCGGTAGA
TGCTCAGCTGGTTATCTTCGTTCATGAACCATCCTATCCGTCGAAATGCATACCCAGCGTCGATCTCGATCTTCCAGTGGCAAACTTGCCAGTAattttc
ttcgtcgtttgGATCCAAAACGTAGTGTCGCCGAATTCGATCTAATGCACCACTTTTTCTGGGTCCACCTTGGTAGTGTTCCCGGTCGACAGCCTGCGCT
TTACCACATATGCTATCTATTTCGTTCTTGACATCTTCGCGATTCTTGCAAAAATCACGAAGACTGCCACCACTGTAACAGTACTGCTCATTGACGAGAT
CAAAGGTGCCTTGACAATCTTCTCGGCCGAGACCAGTAGCCTTTTTCCAGTCATCTAGTGTTGACTCAGCATAGTGCAGTAAATCATTAAACCGCCACGC
TGGCAGCACTACCTCACTGGTCAACTCATGGCTGTTGTACTCATCCTCCATGGATGTCGCGAGAAGTTGATAAGGAAAGAGGCCAAACTGCTGATCCACT
TCCTTTCGCGAATAGCCGTCAACAAATATTAAAGCATCTTGGAACTCCTTCCTATCAGGAAGCGCCACAATCTTCGCAGCGGTCAAATTAGCCTTCCGAA
TGCAAGTATTACTTCCACCATCCAGGTAAATTACAGCACTCGAGCCCGAAAAATTCTTCAAACGGCGTACGGTTAAAACCTTCCTTTTCTCAACCAATGC
CAGGTAGAAGCTCACAAGCATCAGGAAGCACGACTTGCCCACACCCATCGAACCCACAACTACAACGCGCTTTTCCCGTGTCGAGAGAAGTCGCATCACC
AGACCCCAAAGCACAATCTCCTCCTTCCGCACAAAATATGACGACGGAAATCCTCCATATTCTTTGCAAAATGCATTAAGAGCACAGGTCGCAACCATCT
TCTGTTCGGTCTGTTTCTTTTGTCCCAGCACATCAAAcagaagacgcagctcctccacagAATCCCCAATAGTCTCCAGATTTCCAACCGACTGTTCGGA
TCGTTTCCTCTTGCCCGTAATATCAgcttccacctgcagctccgaggTCTTCAAGGGTGCTGGAATCAGAACGTGGACAGCGTTGGCGTCACGGTCCTTG
AAGATTCCCCATAATTGGCTCATGGGCGCCAGGTGGCCTCTCTCCAGCAAGATTTTGGCCGGTTCAATGTCACCGTTCTCGATGTTTTTCACGTCGGCAG
CAGAGAGCCACTCGCCattgtccttcttggccagatACACTCGCAGCTGGGCGGCGTTGAAGTCTCCGAAGATCTCAACAGCTTCGTTCTTGATCGTCTT
CTGCAACTCCCACACGCGGTCGCACCCTTTGACGATAACGGGGAACGCCGTCCCAACCATCCCTACGATCAAGCACCATAGTTCCAGCTCAAGGGGCTCT
TGCGGCTCCG