Description :
From Genome Similarity Track
Location :
Scaffold_514:4874- 6458
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_514-snap-gene-0.7Amino Acid/Auxin Permease (AAAP) Family

Sequence
1584 bases(100 bases per row)
CTCCAATCTACCTCCTGCCTCGCGAGACCTCTTCCCCACTTCTTCGAGCCCAAGCAAGCATTATGAAGAGCACGAGTTGGTTCACCCTCGAGGACTGCAA
GATGGCGTTCAACCTCTTTTGCTGTGTGTACGGCGTCGGCACGCTGGGCATGCCCGGGAACTTTTCCCGTGCAGGTCCGGCGATCGCCATCGTGGCCATG
CTGTTCATGGCGGTTGCCAACATATACTCGTCCATTGTGTGCTCCAAGATCATGCTCAAAGCACCGCGTACGGTCAAGACCTTTGGCGATCTTGGCGAGT
GGTGCATGGGGCCAGTCGGCCGTTGGATCATCGTGTTCTTCCACACGGCTGTGTGCGTGCTCATCCCGTGTCTCTACCTCGTCCTCGGCGGCACATTCCT
CCCCGGCCTGTTCCCCGACACATTCTCTTCTGAAGTCTGGATCGGTTTCATGGCGGTCAGCCTGATGCCGATCTGCCTGATCCCAACTCTGAAGGAGGGT
GCTGGAATCGCGCTCGCAGGATCCTCGCCGACGTGCTCGGCATCGCGATTCTCATGCGAGGCATGAAGGGCCATCCGTCCGTGCCCAAGACCGGTATCTC
ATTTGACCAGATCGCCATGACGTTTGGAAATCTGTCACTCGCGTACGGTGCCGGCATTGTGATCCCGGCCTTGCAGCGCCAGCACAGCGAACCCGAGCGC
ATGCCGCGCGTGATCTGCGTGACGCTGACGATCGTTTCGGTGTTCTTCATCACACTCGCAAGCACTGGTTACTCTGCGATCGGCTGTCAGATCGCTGGCA
AGTTGCTGTTCAGTATCTTTCCCCATCCTTCGACAGGTCTCGCAACACTTGGGTTCTCGCCCAATAAAGGGTGGGCGATCCTCGCGTTCTTGTTCATGCA
GCTCCACATCACGGTCGCATTTGCCGTCATTCTTCACCCAGCGCTCTACGTCTTTGAGCGAACACTCTTGGGCATGCACAAGCGCCAGGCTGAAAACGAC
CAGCACATCCAAGACATTGAGGCTGCCGCTGACTACGTGGTCGCTGACACCCCCGTCGAGAACACGGATAAGGCGACGCCGACGGCAGAGGACAGCAAGG
CTGCCATGGGACCCAAGGCGCCACGTGCCTCCAAGACAGGCTCGGTCGTGTCCATGGTGGATATCATGCGTGAGATCGATGACGAAGACGCTGAGCTCGC
CGAGTACAAGGGCCACGAGTTCAAGTACATTCCCATGCGCATCGTCCTGATCGTACGATGACGGCGTTGTCGATCGCGCTCAAGGACCACTTTAGTGACT
TGGCCGATTTCGTCGGCGCCTCGGCCATCTCCGTGAGCTGCATGATCATGCCCATTCTCTTCTACTTTAAGAAGCTCTGGACGACGCTGCCGCTCTGGGA
GAAGGCATTTGGCTCGCTCGTGGTCGTCGTGTGTGCTGTGCTCGGTGTCTACGTGTCGATCCAGACGGGTAAGGCGCTGTTCAAGTCGGGCACGCCCAAG
CCCGGCGCACCCGTGTTTGAGTTCTGCCACAAAGAGCACCAGTTTGACGTCTACTACAACGCCACGCTTGCACACAGTGGCTAA