Description :
From Genome Similarity Track
Location :
Scaffold_418:4872- 8255
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_418-abinit-gene-0.28Major Facilitator Superfamily (MFS)
Pytar_ATCC12531maker-par_contig_418-snap-gene-0.17Sjogrens syndrome scleroderma autoantigen 1 family protein
Pytar_ATCC12531maker-par_contig_418-fgenesh-gene-0.1Eyes absent family protein

Sequence
3383 bases(100 bases per row)
CTCGGCAGCGCCGTCATATGTGCCCGTGGCGTCGCTCATGGCTTCGTCAACTTCCACCACGAAGTTTCCTCCAAATGCCGGAAAGAACCAGTTGACGCTG
ACTGCGTGCCTCATCGCGTTATCGTCGTTTCTCTGGGGGTACGCCGTCTCCGTCCTCAATGTGTGCATCGTACCCGACGCTGTCGGGTCGCTCCTGGTCG
ATATCAATCTTACGACCGAAGAACAAGAGACGGCGACCGCGCTCGTGCTCGTTGGCGCGCTGCTGTCGGCCCTGCTGTCCGGTGGACTTGGCCAGCGCAT
GGGGCTCAAGACGGTTGTCCTGCTCAACAATGTCTTCTTTCTAGCGGGCGGCGCTGCCTGCGCACTCGCCGTGACCAAGCGCGCGATCTTTTTGGGTCGC
TTCAGCATTGGACTCGCGTGCGGCGTGGTGACCAACACGGTACCGATCTTGCTGAACGAGATCTCACCGCTGGGGATGCGTGGCCGCATCACGTCGTACC
ACCAGCTCATGCTGACTATCGGTATTCTCGCGACCGGCATATTTGGTTGGCTCATAGTGGAGGACGTCCCGTCCGGATGGCGATACCTCAATGGTTTCAT
TATCGTCCCGGCCCTACTCCAGCTCATCACGGTCTCGTGGATCCCCGAGAGCCCGTACTGGCTCATGAAGTTCAAGGGCAAAGACCAAAGTCGTCGCACG
CTGATGCGGTTGCGGGATCCGCATAACCGTGATGCCATCGAAGCCGAGCTGTCAGAGATTGCACTCACGATGGAGACGAACGCTGTTGCGCGGTCGGCCG
AGTGGAGCGACCTGTGGGAGTACAAGTCGGTACTGCTGGTGGGCTCGATCATGGTGTTCTTCCAGGCGTACGTACTATGGCAATTACTCTGCTCACTATC
TGGGTCTTGTTCTGACTGGTCGAATTGATCTTGTCGCCGTAGCATGACGGGCATCAATACAGTGATGCTGTACTCTGCCAAGATTTTCCACTTCGCGGGC
GTCACGAATCCGTTTCTGGCGACGGTCGTCGTGGGCGTCACCAACGTTTTGGTCACGGTACTCTCCGTGGCGCTCGTAGATTCCCACGGACGGCGTCCGC
TACTGCTCGGTGGCACATTGCTCATGATTGGCTCGTTGCTCGTCTTGAGCGGGAGTCTGTTGTGGCTCAATGATAGCCTCCACTGGCAGGCCGTGCTGGC
GGTCAGTGCTGTGCTCCTGTTCGTGGCGGGCTTTGCCGTCGGACTCGGCGCGGTGGTCTGGGTTGTGCTCGCCGATATCACGCCAGTCGAGATTCGCTCG
CGCGCGTTTTCGCTGTTCATGGGGATCTCCTACGTGTGCAACATTCTCATTGCCGTGTACACGCTTTCGGCAATCAATTACCTGGGACGCGGCCCCAACC
CAGAGAAGGACGGCATCGCCAAGCTGTATTTGATTCTGGCGGGCGTCGCCGCCGCGGCATTGCTGTTCATTTCGTACCGCTTGCCCGAGACTTCCACGCC
AGCAGCGCAGGCGGCTCGAGCTGGAGGAGTCATGAGCGAGGAGCACAGCGCATTGCTGCTGCCCCAAGACGAGCAGGACGAATACGACCGCAACACCACG
GAATTGTAAGAGACAACGGATGACCGTGGTGGAGAATATATGTGACTAGGTACTACGTCGCATGTGCAGTATGGATGGTCATGCCGGGGTGAGCGTTTTG
ATGGCGATCGCCAGTTCATTGATGGCCTTGGTGGTCGCCAGCGTGCGTTCGATGAGATCCGTCGGAGAAATGGACGACGTGAGCTCTTCGAGTTTCTGTG
GGACGAATGGTGGAGAGGGAGGAAAAGAGAAATGTCAGTGAGCGTTCGTTAAGCAACCGCCCGCCGCTTGCCACCAATACAATCGCATGGCCATGCCATG
AATGGCAGAATCCGAGGTTGTTGATAAATATATGGCACGAGCTGCTTGTGGTGGCGAGACGATCAAAAGAAAGCAGGATGCTCCACCTGATAAAGCGCGG
CCAGCGTCTGGCGACGGCAGGCTGCGAGGGCATCGTCATCAGCCGGTGTAGAGAGGGTGGCCTCATGGCTCTTGCGCTTGCTGGCGACGGCTATATCAAC
ATGCAGAGGTTCGGTGAACACGTGGAAGCCATCACTCCATGCTTGGGAGCAGCACAAAAGATACCTGGTCCATTCGACGCTGGGGCACGCTGCGGTTGTG
CCACCGGTTGCTGCTGCTGGCGCTGGTACTGGAGCTGCATTTCACGCTCGCGCTCTGCTTGTTGGCGCTCCAGTTGCTCCTGCGCAAACCGCGCCGCAAT
GAGCTGCTCGCGCTCTTCCTGCTCCTTCGCGTCGCGCTCCTCCTGTTGCTGCTTGGCCTCTTCTTCGGTGATCACAAACTGATTGCAGCCCACGCAGAAC
ATTTTGCCCTCGCGGTTGCGCATCAGCGGCGTGAAGCAGTCGTCGCTCGGGCAGTGCGAAGCCAGCATGGTCCATCCCTGGAGCAGCTTCTCGCCGAGCC
GCGCGCTCGCGTCATCGCGCTTCTGGTGTTTGGCCTTGCATCGCAAGACAGTCGCAGGCGGTAAGTTAGCATGGACACAGAGTGCATGAGCCTCGTTGCC
TCACAAAGCACGTGGAGAGACAAGTACTCACGGGATCCATTTGGCTGGTTTCTCGAACCTCTTGGTTGATGTTGCTTGGTGGTCAAAACGGGAGCTTTTC
GATTACCACCTAACAGAGGTTCGACGGTTATTCCGGCACTCAGTAGTATTCTACAATACAGGTACAACGGTATGTCCATTTCCCGCCATTGGAGGCATCA
TTTCCTTTCGCGCGAAGGATCATCATGGGCGACGACGAGCAGCAGCGGCCCGTGCGCGTGTGCCTCACGCGCTGTCCGCTCCCCCCAGCGGACGAGAGCG
TGCACTCTCTCCCCTGCCACATCCACCACGACGGCCCGGCTGCCATCAAGAGCTATTTCCGACCAGAGCAGGAAGCTGACGGCGACCCGAGGAGCTGGCG
CGCCGAGTTTCGCGGCGTGCAGCTGCGCGGGCAGCGCGTGTCGCTCCAGACCATGGGCATGCAAGGTGGGTATTCACCTTCATAACGTGCAAAGGCTTTC
TGTGTTGGATTCGCTGATGCCTCCAGGGCCGTGGTTGAATCACTCGCAGGCCTCGTGATGGAAGACGCCGGCATGACGCACGCGGACGATGAAGGTCGAA
TCTGGGAGGTCGACAACCACTTTGAGGAGATGACGTTCTGGTACCGTAGCTCTTCGCAATTGCCGAGACGTTCTGAAAAGCTCATGCGGATACTGTATAG
GCAAGTGCCCAACAGCGGCGATGAGGACACGAATCTCCCAGCGACGCTCACCGAGTGGAGCGCGCTCGCGCATGCGGTACGTG