Description :
From Genome Similarity Track
Location :
Scaffold_2927:487- 2582
Transcript NameFunction/comments
Phyta_totarag14941hypothetical protein

Sequence
2095 bases(100 bases per row)
ACATGTGATCTTCATGGAACATTTACCGCTGCTGTGTCAAGTTTGAACAAGATCGACGAATATTCGCGATCCAGTGTGACGATGGCCTTGGACATTCGCC
AGGAGAATCGCGTAGATACTGGAAGCACCACGTGCCTGACAAGAAGTTCAAACAAGCGAAAGCTGTGGGGAAGATCAACAACGAAAAAGCAACCATGTTG
TTTAACAGTGGTGCCGAGGTGTCTATTATTGACACAGCATTTGCTCGTAAGGTTGGGTGCTACATTAACGAAAGTCAGACGCTGGGGTGTGAAGGTGTTG
GAAAATCCCCATACACGGCAGACGGACGTACCAGACTCAATATCACGCTCGCTGGATCGTTGATctacttcttcgacgtctGGGTAGGCCCNAGCCGGTA
GACGACCACTCTACGGAAAGCGTGTGGAACAGGTGACCTTGAACGAAGATCGACATGTCGACGTCGGAGGATCGACGGAGGTGAAGCTGCGAGCCGATAG
TCGGAAGCTGTGGATAACCCGCGGAGATCGCTGGGTGCCTACCCTGATAGCAGGCCCTGGCAAGACACGCTACCTGCAGCTGACAAACATGAGCGATCGC
GAATTAGTACTGGATCGCAACATGCGCGTCGGAATGTGGCTGGCCGGAGATCGGGTGCCCCGCTTACCTGGATATATATCGGTGAGATCGTGTAGGTATG
CCGAATGGCAAAACCTGGCCTATCAGGCGACGgtagatgacgacgaagatcaCCAGGAATTGGAGGAGCCACAGGAACCCGCCGTGGATCGGTCGCAGTA
CAAGACTCCAACTGCGATCTTGCCCCGGCCGCCGGAGCGACTGCCAAAAGTAGCAATGCtcggtggtggcgacgactGAGATAGCGGAGAACACGGTCGA
AGGGTTCTGCGAGAAGGCGCCCCAACAACGGAAGAAACGCGAAGAAAAGCGGGTCTGTCGCCGGCTGGGAAGGTACAAGTCAGCGTCAATGAGTGTATTA
AACGCCCAGTCCCTGGTGCAGAAAGGGCGATGTATGCAAAAGATTGCATTCAAGTGATTGCAGATGTCAGGATTCAAGTGATTGCAAATGTCAGCATTCA
AGTGATTGGTAAGATCGAGGCGCAGAGATGGGTGAAAAATCAGAAGCGCATTCTAGATCGACCTGCAAGGATTGGAGAAAACGATGAGGCACTGGGACAG
GACCCGGACGAGAGTAACCAAGATCTCGCTGATGATTACGTTAGAGAacatgcagaagacgaacaGGTGTACatcaaagaagaagatgagctTTACGCAG
AAGATCTCGAAGGGCACATGGCGGTACTGCCGGAGATCACGCCGACGACGGAAGAAGTCAAGATCGAGGATATCCAGGTGGGAAACCCTGAGGACAGTAC
GCcggaagagatcgagcgaCAAGTGAAGATCATCTGGCGTCGCCTACACCTTCTAATTGAGAAGGGGAACGCCTTGCCACCTGCTGCGAAGGGTGCGATC
TGCGACATTGATGTGGAAATGCAAGACCAATAGCCCAACGGATCCGCAAGATCGCCCCGCAATTTCGCGAGAAgctgttcctgctgatcAAGGGTTTGCT
GTCAGCCGAGATCATCCGACATTCGGCGTCGTCATTGGCGTCCCCGATCGTCGTGATCATCAAGACGAATGGAGTCGACATCAGACTCTGTATCAACTAT
CGCCTGATCAACAGCCTGACCCGACTAATGGTGTATCATATGCCTCTTATCAATGATCTACTCGACGATCTTGACAAGATCCTCTGGAATTGCTCGCTGG
ACATGGCTAGTGGATTNGAAGGAAACGAATCGTCGGTGCTAGGTCGTCGATCTTATATTGACGACATCCTCGCGACGGCAGATTCGTGGGATACGTTGTG
CGAaaaggtggagacgctgctaGATGCCTGTCATGAATGGAACCTATCGATCAGTGTTACCAAGAGCTTCTGGGGTTTACGCAAAGTTGGCTACCTGGGC
CATCAGGTGTCCGCGGATGGATTGGGAGCTCACCTGAAGGATCTACTGTCGCTGACCGGTCTGCCATTTCCGGCTACGCTGagatcgatgcagtc