Description :
From Genome Similarity Track
Location :
Scaffold_1224:487- 1898
Sequence
1411 bases(100 bases per row)
CAGCCCTAAATTACCAGGTGGTCCATGTCTCTGGCTCGTGAGGAAAATAAATTACCGATGGCAAAGTGCAGCAGCATACATCCTTCACAAGTCGCACAGC
GCGAATACACGCTGCGCCGCACACAACACCACAAGGTGTAGAAGGATAGCTTTGGTATCTGTGGGGTTTGAGCCCACGCAGACTGGTATGTCTAGCGGAT
CTTAAGCCCGCCCCCTTAGACCACTCGGGCAGGATACCACGCCAAACCGCATCAAAACCGACGTCTCGGACGCGCACTTTCCTCCACTCCTGGCGCTCCC
CACGACAGCGCGACCTCATTTCTGCTTGCACGTCGACAGCACGCAGCTCATAGGCTGCTTCTCGCCTGCCCGGGGACACCGCAACATCTCTCAAGAAGTG
ACACCATAACTTCTCCCACACCCAATCTGTCCGACATCAGTCCCTAGCAAATCACGCGTCCAGCTCACCCACACAGGGTCATCAGCCATTAATTACCAGG
TGGCCCCATGTGTAACGGGGTAAGAGATACCCGTTACTAGCTTACACTATAGGACGGAGGAAGCTCGCAATAATAAAACCAAGTCTTAGGTTTGTGTCCA
ATTCAACTCTGATTTATTTAGGACCAGGGCGGCTACCCCTGGCCTCGTGTGAACCACTCATACACATGTCTATATCTGATGGGTCAATAAGTGAGTCTGG
CTCCTCACTATCAAATAATCAGATGATGACACTTTGGCACACGCTACCACTTTACCTACTTATGTAATAACTAAAGAAATATCTACCTACTTATGTAATT
GGAGTTGGGCCTATTACATCACCCTCCTCTCTAAGTTGCGCTTACGCAACATAAGCGCACGGAACACATTTGAAGAAAACTCGAAAACCGACAAGGCGGA
GACATCGGAGACAGCGCGAAGGGCGGCAGCGCCAGCGCGTCGCTGGCGGTGGTAACAAGGGCAAGCCCAGGGTCGACAGGTGCGCCACAAGCTCGTGGAT
GTACTGCGAGGACCGTCACTGCGCGTCTCGGCTCCCAGGACACACATCGACGAAGTGCCCAGCGTACATGCGACTTAGAGGACTCCGAGCTGGGGGCACT
TGGATCACGGACACGAGGAGCCTCACGAAGCCGACTTCGTGGCGCAATGGTCAATGCATGGGGCTTCCAGTCAGAACGCCAGGGTTCGATTCCCACCAGG
CGCATTCACTCACGCACACGCGAGTGTTGTTTTGCTGCCAGAACGGAATAGCTTCGAACGTCTCGAAGACATGAGACTTGTCGACGGAAGTCAACCACTT
GAGCAACCCGAGTGAGCATCAAGTTGTCACCACTGGTGTCACCAGAATTAGGTACTTGTTGGCCACCGTGTCGCCGCTGGTAATCGAAGTCATTTCGGCG
CAGTTGTAGCG