Description :
From Genome Similarity Track
Location :
Scaffold_111:48698- 49724
Transcript NameFunction/comments
Physo_142277hypothetical protein

Sequence
1026 bases(100 bases per row)
CGCTGACATCCAGAGCATTTGGACGGTGGCCACTGACGGCAGCTACTACTTCACGGGTAAACTCGTGCAGCAGTACGCGTCGCTGTGTCTGATGGCCAAC
GACCCAGTGATCGTCGGCACCGACATCTCCCTGCTGCGTCGGTGCGTGACCAAGCTCGAGAATGCCATCGCTCCGTTCCTGGATAATAGCTGGAAGTACA
AGCTCAAGTACGACGCGGTCATGGGCGGCATCGTGAGCTCCGAAGGGTTCGTGACGGGCGACATGAACGCGGACTTCGGCAACACCGTGTACAACGACCA
CCACTATCACTACGGCTACTGGGTGCACATGGCCTCGGTCATAAACTACCTGCACCCGACCTGGTCGCGGATCGGAGAGCTTAACAGCATGACGCGTCTT
CTGCTGCGTGATGTGGCCAACCCGTCACGCGACGACCCGTACTTCCCCAAGTTCCGCGGCTTCGACTGGTTCCGGGGCCACTCGTACTCGCACGGCATGA
CGTCGCTGGGAGACGGCAAGGACGAAGAGTCCACGTCTGAGGACATCAACTTCTCGTACGCCATGGCGCTCTTCGGCAAGGTCACGAACAACGCGCGCAT
GCAGTCCATCGGTCTGCTCATGAGCAAGGTGGGCATGCGCGCCATCCAGACGTACTTCCTGTTCGACAGCTCGAACACGATCCACCCTGTGGCGTATCGT
CCGCGGATGGTGCCCGGCATCCTCTTCGACAACAAGGCCGACTACGCGACGTGGTTCTCCGCGGACGAGTATATGATCCACGGCATCCAGATGCTGCCGG
TCACGCCGATCACCGAGTACGTGCGCACGTCGACGTTTGTGCAGCAGGAATGGGACAACATCCTGTCCAAGCTCGACATTGTCACCACCAATGACGTGGG
CAACTCGTGGCTGTCGCTGCTTTACCTCAACTACGCGCGCGTGAACAAGGCCGAAGCTCTCGTGAAGCTCAACCAGTGCACCATGATGAACGGCCTCTCG
CTCTCGTGGGCGCTCTACATCGCCGC