Description :
From Genome Similarity Track
Location :
scaffold_902:4868- 7446
Transcript NameFunction/comments
g10570.t1hypothetical protein
g10571.t1 short chain dehydrogenase, putative

Sequence
2578 bases(100 bases per row)
AGCGAGTGCATTGCGGCTGCGCCCGCCGACTCGTTTCTTCGCCGCCGCCAATTTAAACTGGAGAGGGGCGATCGTCCGTGCATAGTCAGGAAGAGAGTCC
TGCAGCCAATTAGTGGCGAAGATGAAGTACTGCAAGTCGACGACCGCCGCCGGTAAAGGGAGAGTAGATAGCGCGCTCACCCTTGCAGGGTCATGTCCGA
CGCCACCTCTGGAAATGAGGCGGCCACACCAGAGCACCTCGACCTCGAACAGCTTCGATTTAGCCATGTTCAGCTTCAGCTGAGCGGCTGCAACAAGGGA
AAAGAACTGTCCAAGCACCTGTACGAACTCATCCACCGTCCGGGCACATAGAATCACATCGTTGACCCATACTAGAGCCGAGTGTGGGATCAGCGGAGCC
AGTACCTTTTGCATCTCGCCTTGGAAGTGCAGGGCCGAGTCAGTAGCGCCTTGAGGAACTCGATTAGGCGTAAATACACCATATTCCGTAATAAAGGAAA
ATATCTCGCGACTCCCCACGTGCAACGGTAGCTGCCAAAATCCTTGCGTAAAATCGAACGATGCGAAGTAACCGACCCCACCCCAGTCCTCTCGATATCC
CATGCTATAGTTAGCATTTCCTCACTGAATAACACTCAGGTTTAGCGTCTCCACATGCTGTTTAAATTGAGAATCAAGCCACTGTACCTGAAACAGTGAG
CGTTTCAACGTACAACAGACTCTTCCAACGAGATAGGAGTCTCCAACTCCAGCATACTTATTTTTTCCGAGAATCAATCCTTCCTTGACCAGGGAAAAAG
CCACAAGTGTGTCCACGTAGAGCGACGGAATTGGCGGTAGCCGAACGGGTGTGTTGCGCGACGGTTGCTGAAGCCGAAGGTGTCACGTTCTCGGTTTCAC
CGACTTGGCGGATGACCTCCCTCAGCGATGGTGAGTCAACTACACCACCTCTAGGTTCGGGAACTGATGAAGGGCACACCACAGCACTTCTAACCGACAC
ATGACTTCTAATCTCAGGCATTCCCGGTCCTGGTGTGAAAGTTTCTCCACTTGCAACCGACGCCGTATTTGCGATCCAGCATCACGAATGGCTGAAGGGC
ACGACACACCACTAGCCATTAAAGGTGTGCTTGTGGCCACAGTTGCTCCATTTTCACGAATGAGTGAACCGCCCGGTGCGGTATTGGCCACAAAAGACAC
ACAATCTTCAAGGGAGACTGACACTTGCTCTCTCAGCGGATGGCTTGCAACTGTGGTGAAGTGATTTCGGAGCAGGCTGGACGTGATGCAGATCGACCAG
AAATGATGGGTGGCGTGCGACATGGTGGTACAAGAAGGTTGGATCGTTGAACTTGGGTGGCCTACACTAAGGTGGATCCTGAGTTAGGATCCGAAGAATC
CCGCCTGCCTAAGTGCGGATCCTGACCAAGGAGATCCAAGATCCGGAGTACCAGATTCGGGATCCAGAGGTGGATCCGAGATCCGACATGGGGATCCAAG
GTCAAGGAGTCGACGTATGAAGCTGAAGGTGTATGATCCGAACACACATGGTGTCAGGGTATCTGCAGGAAAGCCGGTATGCGACAAGGATATAGTTTTG
GGATGGGAAGAAAGGGTTCATGATGAGGAAACTGGCTAAGCGTAAATCAGAGTTAATTTTGCCTTCGAGCACAAGTAAAGGAAAGAGGATAGTATATTGG
CCTCCCCTTATAGTTCCTACAAGTTACTACAGCTAAGGTAGATCAGATGATTAACTTGTTTTTCCTGGTTATTCTATTGGCTGGGTGAACTACTGAATTG
TTTGAATTGATTCCTTCTTCTTCTGGATGTTTTTTTGTCAGCGATTGCTCGGAGCCCCCGGAGGGACTCGAACCCCAGCCAAGCCAAGTTGGCGAACTTC
GTGGGTCTTAGCCCACTGGACCACCAGGAGGCTCTTTACTACAGCTAAGACCGGATCCTGATTTGGCCGGCTTACCTTACGCTAGTGAAGATCCCGGATC
CGACGGTGTTGATTGCTTAACCGAAAGATCCCTACTCTCACCCCCCCCCCCCCCCCCCCCCAAACCCCCCCCCCCCCCCCCCCCCCCCACCCCCCCCCCC
CCCCCCCCCCATCCGACCATGACCTCCATCACTAAGAAGACCGTCCTTATCACCGGCAGCACGCGCGGCATTGGTCTCGCTTTCGCTGAGCGCTACACCA
AAGCTGGATGGAACGTCATCGGCACAGCACGCGCTGGGAGCGATACGGAAAAGGTAAAGCTGTTATCTTATCGTTTCAAAAATTCAAGTTACTCACTGGA
TGGGTATTTCAGCTAGCAGGCCTTGAGCCGTTCAAGATCGTCACCCTGGACACGAGCGATGAGGCGGCTGTTATCGAGGCCGCTCGTCAATTGGAGGGTC
AGCCCATTGACCTGCTCATTAACAACGCCGGAGTCGCGGTCCCAGGTGACTTTGTTGCCAGCACGAAGGACGGGCTCGTGCACCAGTTCGAGGTGAACGC
GATCGGTCCATTCCTGGTGACACGCGCGCTACTTCCCAATCTGCAACTTGCTGCAAAGCACCACGGCACCGCGTCTGT