Description :
From Genome Similarity Track
Location :
Scaffold_6:48674- 59941
Transcript NameFunction/comments
Phypl_g270U4/U6 small nuclear ribonucleoprotein Prp31
Phypl_g271hypothetical protein PHYSODRAFT_343735
Phypl_g272conserved hypothetical protein
Phypl_g273hypothetical protein PHYSODRAFT_554409
Phypl_g274DEAD/DEAH box RNA helicase, putative
Phypl_g275hypothetical protein PHYSODRAFT_309064
Phypl_g276HSF-type DNA-binding protein, putative

Sequence
11267 bases(100 bases per row)
CTACCGACATATCTCATGGCTTcttgacgacgctgacgaatCCACTAGCAGCAGAGAAATATTTCTTATTCGCCTCGGCGACACGAGCCTTCGCAGCTTC
GGGGTTCATGAGCTCAATGCCTTGCACGGGCGTGAATGCGAGACTTGACGCCAAACCAGAAAGCGGAGGCTTACTAGCCGATGACGCGGCAAAGTTGGCA
GCGCGCAGCTTTTTGCTCGATTGCTTCTGTTCCTTACGCAAAATACGCAAATTGCCCGACCCTTCTTGACCAAGTCGGCCGGAGGTGATTCCCATTGCAT
TGTCGCCATACTCTTCGTCGGCCGTAGCGAAAGACTGCCGGTTCATTTCACGCCGCACGTCTGTCATCTGCAAtcgctccttcatcttgcgGTAGCGCTT
GCCACCACGCTTGCGGCGCGGTTTTTCGTCTGGAATAGGCAGggccttcttcgtcttggctTTCTGCGGCTCCTGCCATTTCTCCATCTTGCCCACAAGC
TCACTACGGAACCGGGCACCGACTAAACCTTCCGTGTCGTTCTGGTGAGGCTGGCTATCCACGCGCGCCATCAGCGCTAGCTTGCCAGCTACCGCTCGGC
ACGCCTTCATACGCAAATACGGCGGCACACTCTGTACGAGGTCACTGAAAAAGAGGATGCCCGTGTGCttgagcgctgcagcggatGAGAACCCActcag
caccttcttctcctgtCCCAAGACCTGCAAGTTGCACGACGGGATCCGTGCGAGTTGCACCACTCCACCCGCAAGTCCGATAAGCTGCGCAGCGATGCGT
GTGCCCACGAGCTGTGACACGTTCGGCGCCAGGTACTTCATGCGGCTCTCTACGAAGCGCAGAATCAtgttcttgtccttgtccagcgacagcagctcgt
cgcacGCTTCCATGCAGGTCTTCAGGTCTTCCGGACCCAGCGGTTTGCCGCTCGTGCCGGAACCCGTCACGGAGATTCCAATCACCGCTGAACtaggcag
cagcttgggcagctcTTCCACGAGCGTCAGGTCCATCTCGTTGCCGATAGCTTTGACCACGCGAGCGTAGTCCAGAGCGTTGGGCACGAGGGACTCGAGC
TCCGGGAACTTGGCGGCGTAGATCTCGGCGATGAAGCGGTGGAcggcctcgatctcgtcgtcgatctgcgCCATTAGGTCATTGGACGTCACCACCAGGT
CGTACTCGACGCTTCCTTCCTCCAGGGGCGCCGGCttcgaggctgcagcagaggcgtcgtccacgtccacgaaTCGCTGAATCTTCTGCACGTGCGCCAG
GTACTTGGGCGAGCGCTTGAGGGTCGCGACGGCTGTCACACCGCGCTGCTtgacgctggagcgcagcgactcggccaggTCCTCGGTCTTCTCCACTGGT
AGCGCCTGgtcctcgtccacgcgcttccgcttggcCGTGCGCGACTGGGTGGCGCTCAGCGCGTCGGGCATcgcctcgtcggcgtcatcgtcgccttccg
ccgcgtcgtcggcggcgccagcgagagaggaggaggtcggtgtctcctcctcgtcgctgctgcccccgctgagctcgtccaggtcCTCCAGGAACGAGTC
CGCGAGCGTTGACATGGCCGTCCAAGTGGTAAGGTTTTCTTATcctgttttttttcttgtCTGAAATTAATTGTTGAAAGAGAACTGTGTAATATCATAT
GTATCGAGATCTTGCACAATCTAAAGAAAGAAACGACTACAATATGCGGTATGGCAGGTACAATAATTGCGGCTTGTCCAATACAAACATCAAGTCTTTT
CGTCTGCGTACTTTCGGTTGGTGGAAGGCGTTTAACTGCTGAAGAGACAGCCCACGTTCCTCAGTTCCGCATCCTCTTCCTGCCACGCACGCACCCAAAT
CAAGCTCCGAAGAACATGCCGGGCCAAGAAAGCAACGCCGACACCAACAACTGGCGCCGCAAGACGCCCGCCGGCGGCCGCaaggacagcgacgccgaac
accagaagaagaagccgcgccgcggcggccgccgcaacaacggcagcaagaacgccggcgacgcgcaggcgccgcccgcgcccgTCGCCGCCTCTCCCGT
GACGCAGGAGGCTGCTCCTGCGGTGGAGGCCCCCAAGCCCTCGAACCTGGACTACCTGTCGGACGTGCTGttcgcgtcgctggacaTCTCGTCGAAGACC
AAACGCGCCATCGTGGAGGACCTCAAGTACGAGCGTCTCACCAACGTGCAGAACGAGACGTTCCCGCTCATCCTGGAGggcaaggacgtgctggccaagg
ccaagacgggCAACGGCAAGACCATcgccttcctgctgccgGTGATCGAGAACATGGTCAAGGAGGGCCGTCGCTCCGGCGTCATCCCCACGCTGGCCAT
CTCTCCCAcccgcgagctggcgctgcagatcgctaccgaggccaagcgcctcACCAAGTTCCACGAGCTTAACGTCGCCTGCTTCGTGGGCGGTGCTAac
atcaagaaggacgagcgCACGctcacgagcagcgcgcctGTTGACATCCTGGTTGCCACCCCGGGACGTCTGGTTGACCACCTGAAGCAGAACACGGGCC
GGATCGCTGACCGACTCGGCAAGTCCAGTGTCCTGATTCTGGACGAAGCCGACCGCCTGCTGGACATGGGCTTCCGCCCCGATGTCATGCGCATCATCGG
ATACCTGCCGAAGCAgcgccagacgctgctgttcagcGCCACACTTCCTGCTTCCAccgaggagctgaagcggGTCGCGCTGCGTCAGGACTATGCGTTC
GTGGACACGATCGATGAGAACGAGGCCGACACGAACGCGCAGACCGAGCAGGAATACGTGGTGTGCTCGCTGGAAGATGTGATCCCGAtggtggagcgcg
tgctgacGGAGCACATGAAGCTGCCGGCGTACAAGGTTATGCTGTTCTTCCCGACGGCCCGTTCCGCACAGTTCATggcgcagctcttccaggcCGCTGG
CTTCCCGGGCGTCCTGGAGATCCACTCCCGCAAAAGTCAGGCGGTGCGCACGAAGACTGCTGAGGCTTTCCGCAAGGGCCACAAGGTGATGATGTTCTCG
TCGGACGTGTCGGCTCGTGGTGTGGACTACCCGGACGTGTccctcgtgctgcaggttgGTCTCACCGACCGCGACCAGTACATCCACCGTCTTGGTCGTA
CGGCGCGTGCTGGTATGAAGGGCAAGGGTGTTCTCGTTCTGTCTGAGTTCGAGACGCCTCTTCTAGACAAGCTGACGGACCTGCCTCTTGGGCCGAGCAA
GAACCACTCGCCTGAGATGTTGgtgtcgtcgcagtcgcacACGATGAAGGTCATGAAGAGCCTGAAGAGCTACAGCGACTTGGAGAAGTCGGCGCAGCAG
TCGTACCAGGCGTGGCTCGGTTTCTACAACTCGCACACCAAGCGCCTGAAACTGAAGCCCGTGGAGCTTGTGAAGCTTGCGGCCGACTACAGCCGTATCA
TCGGCCTGGACGAGGTgcccaagctcgagaagaggACACTCAAGAAGATGAACCTCCTCGGCGTGCCCGGTATCGAGCCGTCGCCATACACGCGTGACAA
CGGCGGCAACTCCAACGGTGGCCGCAACGGCGGTGGTCGTAGCGGTGGTGGCAACCGTGGCGGCTACGGCCGCAGATAAGTCATCAAGGTTGCTGCGCCA
ATACCGCAAGGCCCAAGTTACTCAACTGCGTCTCGGTGACTGGATTTCGTGTTGAACACCAGGTGACTTCCTCATCATTAGAACCCAATCGTAATTTATT
GCAACGAAGGATGAGTCGGTTGACTAGAAATATACTCCCATGAATTTCACGAGCTTTGCTCCTGTCTGCACTTGATCCTGTGTAGCCATGTATATAAAGT
TAAATTTGTCCCACACTTTGAAAACGATGGACGAGATGGCTAAGATGTTAGAGACCTACGCGGGCGGCCTGCACCAGTCGTTCGAGTCGgtcttcgagcg
cgtggGGCAGAGCTTATCGCAGAGTGCGCAGGTGATGCGCATGATGAACGAGGTGATGGAGTCGGCCATGATGCAGAACCTGTTCGTATCCTCCGGCTAC
GAAGTCAGCGGAGGACTGATCATCGAGGTGGTGAACCGCTCGCAGATCATGTTGGGCCAGACCAAGATCCGCGCGCGACTCTACAATTCGGAGGAGACAT
TCTTCTCTGCGACCCTCGAGTCGCTCCGAGCGGGGGGGCGGGTCCAACTGCAAGCACCGATTCATGACGTCGTCGGTCCCGTCGCGGGGATTATCGAGTT
GGAGTGCATCAGTCCGggcacgcagcagccactcACCAAACGCTCGTCGTTCCGGGTGTTTTACCTCCAGCAAGGCACGTTTCAAGTCCTGCGAAGCGGA
GAGGAAGGAGCGGCGCCTGGCCCAACTGAAGTAGCGGTGGCGTCCGACAGATTCCTGCTGACAAGAGTGAGAGAGATCCTGGACCTCAGTCCGATCCATG
GCATTCTGACTGACGAACACGGCAGGTATCGGTTCCACCCACACATTCCGCTACGCAACAACGACACGGTGTTTTATCTCTCCGTGAAGGAAGGGAGAGC
AGGCGAGCCCGCATACCAAGTCACAGtgtctgctgcaggaagtgctAGCACCGCTGATGAACGTCGACGTCAATGCCAGCAGATAATCGATGAGATGGag
atcgtcgacgacgatgattCGGACTACTAACAAGCATTCACTTCGCAACAACAGAAGCATGTACTTGTGAAGTAGGTGTCATTAGAGCGCTACAAAGTTA
AGTAAGGATGTGGTACAAAAAGGTATTTCGGTATTGGGGATCTCTATCGCCACTTTTTTCAATGGCTCTTTGCTAAGCGACCACCCTCCCGTCAGCTGCA
AAGACCGCagcgcttcttcacgctgctctTTATTCAAGCCGCACTTTCATCATGGTGTTTACGCCCATTGGCGCTTGGAGAGGTAGCCGCGATCGCTGAA
CCACTTGTGGAGAAAGAACGACTGCGCGCCGTAGATGGCGCCCAGCACAGCCAACTCGAACATCGTGTAGTAGATGATGCGGGATTTGCTGCTCTCGAGT
GCTGTAACACCATAATCCAAGCCACCAACCGTTAGTGCATCCAGCAAAGATAGATACTCAATCACAGCTCAGCCAACGTGCTGCTTACTCTGAACATGGC
GGTGCACTCGGGCGCGGTAGTAGTCCTGCTCATTGCGGatgagcttcagcagcgcatGCAACCGATCCAGCGACGTCTTCACGCCGTCCTTGTGCTCTGT
TACCACCACCAAGCAGAACCGCACACAAGTACGTCAGTTAGATGCCCGGCCACCTCTCCTCTCAACTAACTCATATAGACGCACCTTGTCGcgcctgctc
gtccagcttgtcctcctcgcccagaTCGTCCTCGTTGGACAGGTCGAAGGACGTGTACCACTCGACCGTCTTCGTCCTGCCGTCGTGCATGTTGTCCAGG
CAGAAGCGGTACCATCCGCCGCGGTGCTCCGActcgaagttgaagccgcTGTGCTCGACGTTTTGGTTGATCTCATCGTGCGGAGTGACCACCAGCTGGT
CGAAGAAGTTCTTGTCtacctgctcctgctccgggTACGAGGGGAACGGGCCGAACGCCTTCAGTCGCACGTCGTAGGCGCCCGTGGAGTCCAGCACGCC
GATCTTCATGAACGCCGTGCGCTTGGTGCGCACGTAGTCGTGGAAACACTCCTCCACGCGGCcctccagcttcacgatCATGGCGTCCGAGGACGCGGGt
gccgccaccagcacagcgagagacgccgccgccacacGCAGCAGTCGTCCGAGCGCCATCGTCAGCCGTATACAATGCTCCCAGTCTTGTCGGTGTCGTC
AATCGGACAATGAGAGCCGAGATAGGTCTCACCTGACGTATTTGTTTGCTATTTTTAGCCAATCTCAGCCGACTAAAAATACCACTGCTGCAGACCTACC
ATTTTAGTTTGGCGATGTGGACGACTCGCGGCCTCTCGACGAGCTTGCTGCGCGGCGCGACTACCGCGCGCGGCTTCCGCTCCAGCTGCGTCCCATGGGC
GTCTGCTGGTGGCTACTTGTCGGACGTTTCGTTTGAGTCGCTGCCCATCAGCCAGCGGTCCAAGGATGTGCTCACGGGCGCCATGGGCTACGAGTTCCTG
ACGCACGTGCAGAAGgacacgctgccgctggtgctggacgggcgcgacgtgctggccaagggcAAAACGGGCAATGGCAAGACCATCGCCTTCCTGCTGC
CCTCGCTGGAGCGCATGCTCACGCACCCTCAGACCAAACAGGGCAAGATCTCGGCGCTCGTGATCTCCCCgacgcgcgagctggcgcagcagatcGCAGT
CGAAGCGgtgaagctcacggacgCCCATGGACTGCGCACGGCCTGCTTCgtgggcggcagcgccgtcaacaaggacgtgaaggagctcgcgcaccCTGGA
ggcgtcgacgtgctggtgtCCACTCCGGGAAGACTGCAAGCCCATTTGGAGGACAACAGTGGACGCATCCAACAGAAGCTGGACAGcctgcaggtgctgg
tgctggatgaagccgaCCGCCTGCTGGACATGGGCTTCCGCCCCGACATCATGCGGATCATCAGTCGTTTGCCGAAAGAGCGACAGACGCTGCTCTTCAG
TGCGACGCTGCCGGCTGcgacggacgagctcaaggacgtggcACTGAAGGATGACTTTGAGTTTGTGGATACGATCGAAGGTGATGACCAACAGACCAAC
AGGCAGACGGTGCAGGAGTATGCCGTGTGCAACCTGCAAGACGTCATTCCCGTAGTTGAAAGTGTGCTGGAAGAGCACATGAAGCTACCGGCGTACAAGG
TCATCGTTTTCTTGCCTACTGCACGGTCCGCGCAGTTCATGGCGCAACTCTTCCAGGCTGCAGGATTTCCGAGTGTTCTGGAGATGCATTCGCGCAAGAG
CCAATCTGCCCGTACTAAGGCTGCGGATGCTTTtcgcaagggcaagaagatgATCATGTTCTCGTCTGACGTGTCAGCGCGTGGCGTGGACTACCCAGAC
GTATCGCTTGTCTTGCAAGTGGGTCTCACGGATCGTGACCAGTACATCCACCGCCTAGGACGAACTGCCCGTGCGGGTATGGAGGGACGCGGCAttctgg
tgctggccgacttTGAAAAGGCAATGCTTCGTGATCTAGCCGATCTGCCGCTCACAGAACTAGAGCAGCGTCCTCAGCTGGATCAACAGAACTACCGAAC
TACTCGCGCCCTCACTCAAGTTCGCCCCGGCAGTGGGCTGGAGCAATCAGCAGAGAAGGCGTATGCGGCTTTCTTGGGATTCTACAACTCgaacctcaag
aagctggggATGTCGAAAACGAAGCTTGTCGGGACGGGAGCTCTCTACAGCCAGCTTGTTGGACTGGAAAAGGTGCcgatgctgcagaagaaggcaTTGC
GAGCGATGGGGTTAATGGGCACTCCAGGCCTTACCGCTGCTTCCACACCGGTTAGAGCAGGAGGACCCAAGTCCAGAAACCCCGGAGAGCTGAAGAGGTT
TACCAGCGAAAATCGGGGTAGCTATCAGTCGATTCATGGTCGAAAGCAGCAGGAGAGTCGTGAGGGCAACGGAAAGCAAGGGGATGGTTCGTGGAAAACG
TTCAGCGACAACGATACCATGTATTCCCGTAGCGAGAAGTCATTCAAGAGCGAtcgcagcagccgaagcacTTCACCGAGCACTAGACGTGAAGGACCCT
CCTACGGACACAAGCGTTCCTCGAGCCCTGAAGGACGCTCCTATGGACACAAGCGTTCCTCGAGCCCTGATGGACGCTCCTACGGACACAAGCGTTCCTC
GAGCCCGGCAGCCAAGCGGGATTACAAGGAGCCGCACAAGAGATACTAGAAGATAACGACTTCATGATAGGCAAGCGGCGTACGATGCGGACTACCAGGT
GGGTATCCTCTGTTATCGTAGACCACGATAGATTTGTTTTGGTCGTAGCAAGTAAGCGCAGCTCATACTCTGTCTGCATCTGCCGTTACTAGACCAACAC
CACCTAAATGATAAAGCACGCAAACTCCTCACACGCCCATACGTTGTGTGCCTACGCAACGGACTGGTACCCGGTTCGCCGTTGGCGCTCTGCAGCAAAC
CACGTAGCGGAGGCACCCACAACGGCCCCAACGATAGCACCGATGCCAAGCTGAGCGATTGAAACAGTGCTCCATGACGACGAACATGTACCGTTAGAAT
CCTGCGCTCCAGGACTGGCACTCGCATTCTGGCGACTTTCAAACATCTGAAGCTGCTTTTCCAGCTCTGGAATGTGCGGTGGTACTAGCGTCTCGCCTGG
CCATTTGGAGAACTCACTGAGCTGGAGCCACCATTTTGGGTAACCTGGCATCTCCATTTCCTCGGGAGCTTCGCCTGTTGTGATGTAGCCGTCCGTGAAT
TTACCCACGAGCTTCCATGCGAAGGTCCACCATTCCTCGATGACTCGCGAAGCCAATCGATTGGATCGCTCCTGCAGATACACACGCGCTTCGGATGCGG
TCAAGGCTTCCGCGTGAGTGACATGATGCTCCATCGCCTTCCGCTCGACAAAGCAAGTATTCTGCAACTCAGCTATTCGAGCTCGGATATCCCTGCTGAT
AGCGTCAAAGCGAAGCATGCTCCAGTTGTtcacgaagctgaaggcccACCACGCTGATCCGAGTGTAAACTCGCTTTCCTTGCCGAGGACGTAAGACGGT
ggaacttcttgctgcgcaCAGGAAAATGGCACGTACACCGAAGCATGCGGCGAGCTCTGCGCGTACCAGGCCACACCGCCAATCGCATCAGGAAGGTGGC
CACGCGCCTGCAGTACAAAACTGTAGACGGTGCGATACATGGAAATCGGTCGCTCCCAGCCACCTACGACTCCCTTTTCGTCGCCCCCCCACCGCATAGG
ATTACCGAacggtccagcagcaagacccTTGGACAAGTCGTACGGCGTGCCTTGGAAGTAGTCGCGCAGTAAGCGAGTGACGTCCGCCACATCGAGGTTC
CGGTCCGGTTCAACTGAAAACGGGTACGTCGGAAACTCCGGGTAGTGCCCAAGACGAGGGTCTAGCTGCAAGGACGGCGCCACAAGATTGAACACGCGCC
ACATGCGACGACCCATATACAGCGTGCGCACGGGATCTGGAGTTGGAGCTGCGTACACGGCGGTGAAATCGAACTTGTCTTGCGTCGGCTCCCACCACCC
CATTTCTTCAGCAAATGACAGCACATTGTCCGACGCTAGGAAGCGGTCTGGATCATCCAGATGCATTTCACGGATCACGAAGCCAttggccaccacgacc
acgtgcGTATCAAGAACGCGTTGGGCCACCCACACCGCACTAGCGTTCTGCGGACCTGTCAGGACGTGGAAGACCCACACTTCTCCGTAGCGGTCGGCAA
TGCCCAGCGTCTCCGCTGAGCTCACATACCCTGGATTGGCCGGCTCGCCGCTGTCTTCACTGTAGAATCCGTACTTGACAGCCAAGTCGCCCATGGTCTG
GATAGCGCATCGAGCCGAGTCGCAGCGCTCCAGAGCCACTTTCGTGAGCTCTCCGATGCCGAACATGTTGTATCCGTGCGGGCCAGCGTCCGTGGGCCAG
CCGGCCGTCCTGGCACCGCTCGTGCTCTCTCCGATGCTGAGCTGCACCTCGCTCATGAAGCCGTAGTCCTGGTCGAAGTAGCCGTAGGTGTGTGGCACCT
GCGGGATCTCACCGAGCGGCGTcatgagcagctcctggtcgtTCTTGGGCTCGTACTCGAGTCCTCGCTGGGTCGTCACGAGACGTGGGTAGCCTGGCTG
CACGTTGTACACGCGCCGCGTCGCCCCTTCCTCGTGGTCCTGGgcgggcacgcgcaccatcCGCAGGTCGGCCGCGCCGAAGCCCGCGTCGTCTGTGTGC
GCCACCAAAGTGGAGCCGTCGACCGTCGCGTTGCGCCCCACCGCGATCATCGTGCAGGCTctcaccagcggcagcagcaaagcgagcagcagcgacggca
agcaTGTAATACGTGCCTTCATTGCTCAAAGGTAAGAGAAACTTGAAGTGGTGCCGTTGGACTAACAGGATCCTTTGTATTCACCGGTCAGTTTGCGCAA
AGTACGAATTGTGGAATTTGTGTAGGGTTCAGAATAATGGGGCTCTGTCGACGCTTTAGTGAGAAACTTTGTTTGGTATAAATAATGTTGTTGGAGTTGA
CTACCATAAAATACGGACGGCGACGGACACTTAGGCCATGAGGCGAGGCCGGATGGGGCCGATGGCCGCGTACGGCAAGGCGCgggacagcgacagctcg
cgGATGGACGGCAGCTTGTAGCCGCTGTTAACCTTGCGCGCGGGGGACAGCACGGGCAGGCTGAACAGCGGAGCCGGGTGCATCGGCGGGGACATGACTC
GAGCCAGGGCCGGAGCGGCCACGGCGACCAGCGGGGCGGCGGCACCGGGGCGCGGGAGAATGGGCTTGCActtctcggcggcgccgtaggccacggccgc
gcgcttggccggctgctgctcctcgtcgctggaagCTTTGCGCTTGCGCGACTTCTTGCTCTGGCGCTTGACCAGCGACATCTCGCTGAAGTTGTCGCGC
GTAAAGTGCTTGCGGCTGTAGGTGGGGAACTGCGCGCGGGCCTTGCTCCACTTGCGGAAGCCGAAGTAgttgagctggcgctggaagctcgagaagttct
tgttcttgaagTACTTTGGCAGGATCTGCGAGGTCATGGCCTCCTTGTCCAGGATCTGGAAGGCCATGCCGTCCTCGGCCCAGCGGAGGATCTTGGGGTC
CTCGCGCCGCAGCATCtggtgcaggtgcagcaggaacggGGCCACCCAGCCGCGCTTCGGAGCCTCCTCcgtcgacgaggcgctggaagacacagagctg
ctgctagccACCGACAtcgccggcgacggcgggcACGCGGGCGCCGCCTCGCTGGAGAGCAGGTCTTGGACGTTCATGGCGTGGAAGTAGGTGCTTGCGC
TCGACAATGCAGAATCGGAAATGAGACTGGCGGGCGGACGGagcgcttcctcgagcgGCATACTGAATCCCCTTTGTGTTTCTTTTTTTGAATCTAGATT
CGATCATCCAGAAGTTACCACAGATACCATGTCATCTACCCCTAGCGAATCTTGTGAGGGGAAGGGT