Description :
From Genome Similarity Track
Location :
Scaffold_11:486717- 491045
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G005001Similar to PEG10: Retrotransposon-derived protein PEG10 (Homo sapiens)

Sequence
4328 bases(100 bases per row)
AAGTTCCTCTCAAGTCTTCCTCTCAAGCGCAAGCGTGCGTGCTGTGTTTGAGGCTGTCTCGGATAGCCTCTTACACCTGGTAGCACTTTGTAGTTCTTCC
AACGACCAAGTCAAGAGTCTGCATAGGCCGCTTGTGTAGCGTGCGCGGACATTCCAAGACCCCTGTCCGATTGTGAGAAACAATGGAAGGGATTGAGACG
CCGATGGGCTCGATGCCTGGAGAAACCGTGGAGCTGACGAATGAGCATTTTCCTCATTTGTCGAGCCACGAGTGGGCAGCCCTCGAGCGTATGCGAGCGG
TCATCGGTGAGGCGGCTGTGATCAGCTTGCTGAAATCAGCGTCACCGGATGAGCAGAGGAACGCGGCTACGAGCTTCATGCATCACGAGATCATGAACTC
TCATCGACAGTCTGCAACTCCTGTCACGACAATGAGAGTAGCACCTCTGAAGCTCGATGTATCTTCGTACCGTGGCGGAGAGAACGAGCCTCTTTCGAGA
TGGTTCGTCGAGTTGGATGCAGCGATCACTGCAAGACAACTACGGGACCCAATACAGCAAGTGTTGTTTGCGATGTCAAAACTTGCGGGTCGAGCGAAAA
GTTGGGCGTATGGGAAGCGATTGGCGGAGCCACATTGCTTCTACGACCTGGACGACTTCAAGCGAGAGCTGAAGAAGGCTTTTGAACCTTCACAGAGCGA
ATTTCGGGCTCGCGCAGAGTTCTTAAAGCTTCGTCAGGGTAAATACGACCTACACTCGTACGCTCAACGAGCACGATACCTTGTGTCAAGTATCGTGAAT
GAGCCGATTGATGCCTCAACACAAGTTGTGACATTCATGGCAGGGCTCAATGATGGTCCAATTCGGAACCAGTTGTTCCGCGAGTACCCCAAGACGCTGG
ATGAAGCTATCGAGCGAGCGATGCAAGAAGAGTTCAGCATTAAACAAGCCAAGTTCGGCGGTTTTGTCACTCGACCTCCAAGACAACAAGCGACAACATA
CAATGGCCCAGAGCCAATGGACATCTCGTATGCCGATGTGACTGCAAGTCGACAGCCACGCAATGACGGGAAGTGTTTCCGTTGCGGCAAGCCCGGCCAC
ATCACGAGAAATTGCAAGGTGTCCTTGCCAAGCCAGCAAGCGACGCACGGTCCGCGATCGAATCGAGCAGGCAGAGGCCGACAATTTGAGCGTTCCCAAC
AGCCAAAAAACGAGAACGACCAGTAGGAGCGGGGCTCCCTACTGGGCGAACTAAGAGTTCTGTGAATGTCGTGGAAGCGCAGAACTCTTGCCCCGGTGTG
TGTAACGCACATGAAGTTTCCGCGAACAGATGTGAGCGTGTCGAGCAAGAGCCAACCTTGATAGTCCACAAGGTTAAGGTAGATGGTTACTCAGAACCTC
TACGGGCTCTTGTAGACACTGGTGCGTCGAACAATTTTGTCCGCACACAAGTGGTGAGAAGGCAAGGTTTGGACCTGCCTATCTCGAACAAGGAAATGAT
CGTTCGCTTGGCGAATGGGTCGAAAGTGACGATGCCTAAGCGCGTGTTGCGTATGGCAATCGAGTGTGATGATTTCCGAGGTGAAGACGAGTTTATAGCA
CTCGACCTCGATGACAAGTTTGATCTGATTCTGGGAATGCCCTGGTTGAGAAGGTACCAACCGAGCATTGACTGGAAGAAGAAGAAGATCAGCGTCGACA
AGCAAGTCGACGAAGATCTCGGCTGCTTGACAGCAAGAGAGGTGATTTGGGCATATACATCTGTTGAAGATGTGTCTAATGAGAGTCAGGCGTGCGATGG
CCCCTCACACTCAAATGACAAGCCCGTGAAGACCACTGGAGGTGGAGTAGTCAGGTGCCAGAAAAAGACTACTCCTGTGGCCAAGAGCGGTAAAGAGTTC
TGCTCTGACAGGATTAAAGAAGATAAGAAGACCGATGAAGAAGAACGAAGATCTACAAGCGTCCCTGATCAAGACACAAGGAAGGCAGAAGATGAAGTGA
AGAGGCAGGAACAAGCCACTTCAAGTGAATACGTGAACGTCGTAGTCTACAATGAAGAAGGCGACTGCCAGATAGCGCGTCATGCGCAAGTGGAAAATCC
TCCAAGTCTGGCTCAAGAATTGATTTCCTTGCCGTTGATGAGCAAGAAGACGCTTAAGCGTAGCCTGGTGAAAGGCGAAATTTCGCAAATTTGTGTGATC
GTCGATGAAGTTGCCGGCGATGCTATCAACACTGCGGAAGTGTTAGATGAAAGGACACGGAAGGAAAGGCTTGATGAGCAGTCGTGGGACGCTCTAAAGA
CAAACCCCGTGTATGGACTTGTCAAGGAATATGCTGACATATTTCCAGACAAAGTGCCGGACGAATTGCCGCAGGATAGAGGCATTCGTCACGAGATAGA
TGTACTTCCGGGAACAAAGTACTGTATCACAAGGCAATGGCCGCTACCGAAGGAACAAGTCGATGCGATCGATGAGTTCTTCGCGCAGCGACAGAAGGCT
GGCCATGTGCGCGAGAGCAAGTCTCCGCACTGTAGTCCCACCTTTTGTGTTAAAAAGGCCACAGGCGGTTGGCGCATTGTTCATGCATTCAACAAATTGA
ATGATGCGACCATACCTGCTCAGACTCCAGTTCCACGAAAGGATATGATCCTTGATGTAATGGTTGGCAGCACTGTCTTTAGCGCGATCGATCTGAAAGA
TGGATTCTATCAGATTCGTATGCGTGAGAGTGATGTACCATTTACAGCAGTAAGCACCCCTAGTGGTATGCTGTGGGAGTGGATGGTGATGCCACAAGGT
CTGAAGAACGCACCAGCAACTTTCAACAGAATGGTCGCGAATGTACTTCGTCCATTAAGAGAGTTTGCACCGAGCTACTTTGACGACATATTCGTTCACA
GCAAGGCCTCGGAAGGGAAGAAAGATGTCGATGTTCATCTTGGACATCTTCGTCAAGTCTTTCAAGTTATGCGTGAGAACAAACTGTACGCTAACTTGAA
GAAATACATCTTCTTCGCCCCCGAGATCCCTGTACTCGGTTGCTTTGTTGGCAAGAATGGCGTTCGGGTCGATCCTGAGAAGGTCAAGTCTATTGACGAT
TGGCCTATTCCTCAGAAGTCAAACAGCTACGTCAGTGGCTGGGTTTGGCCAACTATTTGCACAAATACACGCGCAACTACGCAGCGTTAGTGCAACCCCT
CACGAGTCTTTTGAAGAAAGAAAATGAGTGGGAATGGTCAGAGGAACATCAGGCAGCGTTTGCCGAAGTAAAGAAGAGCTTAAGAGAAGCTCCTGTCCTA
GCTCTCGCAGACCATGAGAAGCCGTTCCATGTAGTCTGCGATGCGAGCGATTATGCCATCGGGTGTGCACTGATGCAACACGATGATGAGGGCAAAGAAA
GAGTTGTATCGTATCAGTCACGACAACTCAGGCCCGCCGAAAGGAACTATCCAGTCCACGACAAGGAACTATTGGCCATGAAATATGCATTGGCAAAGTT
TCGAGTCTATTTGCTCGGTGAAAAGCAGTTCGCTATTTACACTGATCACGCATCACTGCGGACAGCTGTAAAGACGCCTCACCTATCGCAAAGAATGGCA
AGATGGTTTTCCTTTTTCGCTGAGTACAACTTTGTTGTGCATTATAAGCCCGGCAAGTCAAACATTCTTGCCGATGCACTGTCAAGACGTCCGGATTATG
ATCCGAAGAGCAAGAGTGACGACACGAACGGAGCGTGTCGACTCTGTGAAGACGTCAACACGATTGCTACGGGAGTGACAAGCACAATCCAAGAAGAAAT
TACTGAGGGCTACAAGCAAGACGAAGCATGCCAAGAACTGATCAAGTATTTCAAGAATCCTTCAGACAAGGCACTCCAGAACCTCTCATCAAGAGCAAGA
TCGCGTGTTCACCGTTACAGCATGCACAATGAGCTGTTGTATTATGCGGTTGACGAAGGGGATCCAGCGAGGATCGTTGTCCCCAACGATGAAGGTCTGC
GTCATCGACTCTTGTACGAGTATCATGACAGTCCTTCGAGTGGCCATCTCGGACGCGAGAAAACGTTTCTCAACTTGTCGCGAGATTACTACTGGCCTCA
CATGTACAAGTGGGTTCGCAAGTATGTGCGTACTTGCGAAGTGTGCCAAAGAGTTAAGCCATCTGGCTCAACTCAGGCCCCACTTCGTTCATTACCTTCC
CTCAGGACAGCTGGAAGTCTGTGAGTATGGATTTCATATTCGGACTTCCAAGGGACAAACACGGCAGAATGGCATCCTGGTGTTTGTGGACCGATTTAGT
AAGATGGTGCATCTTACTCCGGTGTCAG