Description :
From Genome Similarity Track
Location :
contig_8:486575- 488076
Transcript NameFunction/comments
g2028.t1XP_009525138.1 hypothetical protein PHYSODRAFT_492736 [Phytophthora sojae

Sequence
1501 bases(100 bases per row)
AACTCACATTGAGCTGGGCTTCCACCTCCAAGTGGCCTCCTTGAGGCGCAATAGGCACCCACATCACAAGCGATCCACCGCCAGTGCCAGGAAGGCCCAG
GAAACCCGGACGCCAACGGTCGAGGTACAACGTCTTGCCACCCAGTGCCGTGATATTGGACGTCCACTGGGCAGTGGCGCCCGCAGCGACATCAATTTCG
TCGATTTTGTCACCGCCAGACATGATGTTCACAGTCACGTCCTCTGTATCCTTGCTGGTGAAGTTGATGATCACCGCACCGTCTCCCTTCTTCGTCCACG
AGATCGTCGTGTTCTTGAAAGCTTTCTTGAGCGCATTCATGCCGAGGGTGGCTGCCTCATTGCCATCGTCGATCTCTCCCATAAAGCGAGTGGGGCCACA
AATGGTCTGCAAATACTCAGAAAGCAACGTCGACAGATCCGTCGGGTCCAGGCCCGTCACTGAGAGAGTGGTGAGGCCATTATCGATCCACAAGTAAGCA
GCTTGCTTGTCATCAATGGACGTGCCGTTGTCACTCTTGCCAGACTTAATGAGGTCGTCGATAATGACTCCGAAGGTCTTGCGGAGCGTCTCGCGCGTCT
TGTACGCGGTGGCCTGCGTGGACTGCGAGATCATCTGGCTCATGCAGTTGTTGGTCACCGTTGCGATGTCGTACATCACAAGGTCGGACTCGCTGACTTT
GAGGCGGACTTCGGCATCGGAGATAGCGGGGTTCTCCTCCCGGTACTCGTTCACAGTCATCCAGACGCGGTTCGTCAAGGACCGCATGTCATCGCCGCAC
GTCGAGTTCTGCTTCATGGCCGTCTCGAGATCCGAAATTTCTCCATCGGTGATCTCGCTGGCAGCCTCGGTGAAGTTGGCTCCCTCCATGAAGGCCTTGA
ACTTGTCCCAGCTCGACACGATGCTATCGTCGTAGGCGAGAATATTCAGAAGGATCCACTGAGCGGTGGCCATCAGACCCTGCGAGAGGCGAAGACCAGA
AGGCACAGCCTTGCCCAAACACGCGTAGATGGCAATAGGCAGATCCGTGACGACGTTGTTCGTCTGGTACAGCAGCAGCAGAAGCTTGTCCGTCGACGTT
TCCGGGTTACTCGTCGCTTGGTTACGCATGAAACGGATGATAGCTCTCGTCACCGTCAGCAGCGAGTTGGTGCACTTGACTGCCCAAGTCACCTTCTTTC
CCAGTTTGGCGAGCTCGCCGAACACACCAAAAGTAGCCATACTCAAGGTGGACATGGCAAGCGCAGAGACCTTGGCGGCGACTTGACGTCCGCAGTCATT
GTTCTGCTGGATGCATTCCATGTTGCACTCGACCGGGTAGTCCATCGGACACTCCGTCCAACAGTGTTGGTCGCCTCGTTGCGGTCGTAGTTGCTAGGGC
AAGTGTCCATGATGTGAGCTTCTCGGTAGCAGGCGGAGTCGGCCGATTGGCTCCAGGGCCCCACCCAGTTGCGGTACGTAGAAGTGATTGTGCTGGTGGC
G