Description :
From Genome Similarity Track
Location :
contig_8:486545- 488087
Transcript NameFunction/comments
g1891.t1XP_009525138.1 hypothetical protein PHYSODRAFT_492736 [Phytophthora sojae

Sequence
1542 bases(100 bases per row)
TCCACAACAAACTCACTCTATCTATCTAACTCACATTGAGCTGGGCTTCCACCTCCAAGTGGCCTCCTTGAGGCGCAATAGGCACCCACATCACAAGCGA
CCCACCGCCAGTGCCAGGAAGGCCCAGGAAACCCGGACGCCAACGGTCGAGGTACAACGTCTTGCCACCCAGTGCCGTGATATTGGACGTCCACTGGGCA
GTGGCGCCCGCAGCGACATCAATTTCGTCGATTTTGTCACCGCCAGACATGATGTTCACAGTCACGTCCTCTGTGTCCTTGCTGGTGAAGTTGATGATCA
CCGCACCGTCTCCCTTCTTCGTCCACGAGATCGTCGTGTTCTTGAAAGCTTTCTTGAGCGCATTCATGCCGAGGGTGGCTGCCTCATTGCCATCGTCGAT
CTCTCCCATAAAGCGAGTGGGGCCACAAATGGTCTGCAAATACTCAGAAAGCAACGTCGACAGATCCGTCGGGTCCAGGCCCGTCACTGAGAGAGTGGTG
AGGCCATTATCGATCCACAAGTAAGCAGCTTGCTTGTCGTCAATGGACGTGCCGTTGTCACTCTTGCCAGACTTAATGAGGTCGTCGATAATGACTCCGA
AGGTCTTGCGGAGCGTCTCGCGCGTCTTGTACGCGGTGGCCTGCGTGGACTGCGAGATCATCTGGCTCATGCAGTTGTTGGTCACCGTTGCGATGTCGTA
CATCACAAGGTCGGACTCGCTGACTTTGAGGCGGACTTCGGCATCGGAGATAGCGGGGTTCTCCTCCCGGTACTCGTTCACAGTCATCCAGACGCGGTTC
GTCAAGGACCGCATGTCATCGCCGCACGTCGAGTTCTGCTTCATGGCCGTCTCGAGATCCGAAATTTCTCCATCGGTGATCTCGCTGGCAGCCTCGGTGA
AGTTGGCTCCCTCCATGAAGGCCTTGAACTTGTCCCAGCTCGACACGATGCTATCGTCGTAGGCGAGAATATTCAGAAGGATCCACTGAGCGGTGGCCAT
CAGACCCTGCGAGAGGCGAAGACCAGAAGGCACAGCCTTGCCCAAACACGCGTAGATGGCAATAGGCAGATCCGTGACGACGTTGTTCGTCTGGTACAGC
AGCAGCAGAAGCTTGTCCGTCGACGTTTCCGGGTTACTCGTCGCTTGGTTACGCATGAAACGGATGATAGCTCTCGTCACCGTCAGCAGCGAGTTGGTGC
ACTTGACTGCCCAAGTCACCTTCTTTCCCAGTTTGGCGAGCTCGCCGAACACACCAAAAGTAGCCATACTCAAGGTGGACATGGCAAGCGCAGAGACCTT
GGCGGCGACTTGACGTCCGCAGTCATTGTTCTGCTGGATGCATTCCATGTTGCACTCGACCGGGTAGTCCATCGGACACTCCGTCCAACAGTGTTGGTCG
CGTCGTTGCGGTCGTAGTTGCTAGGGCATGTGTCCATGATGTGAGCTTCTCGGTAGCAGGCGGAGTCGGCCGATTGGCTCCAGGGCCCCACCCAGTTGCG
GTACGTAGAAGTGATTGTGCTGGTGGCGCCGGCGTGCGTCGC