Description :
From Genome Similarity Track
Location :
Scaffold_18:486384- 492332
Transcript NameFunction/comments
Phyca_LT1534565563PREDICTED: granulins-like
Phyca_LT1534506250conserved unknown protein
Phyca_LT1534506252GL24786
Phyca_LT1534533901Hypothetical protein
Phyca_LT1534545592conserved unknown protein

Sequence
5948 bases(100 bases per row)
cgaagctgttgtttttgagcaacaatggcaatcccaggtgatatcactgctatccagccaaggaataacttcatatcaagctctcctgctttcgcttccg
tcactggcgtacgaagtacaaactgaattgagcaggtgaacgcatcgctctgccagatcagcttcccaaccaacagtcgacaaatcttggaggtgaaagg
gcgggagactgctccagtcgcccctacgctctgttcgagcaccaatatctataaccaccgcacagccagagttgattggtggcggaatgtgtgacgtggc
cgagtggtgatgcaaacggctacagccacaatgtcttaagagaaaaaaaactttggctggaatgcggagagaaaccgcagcggtcacgagaggctgatgt
agctctggatttttgcgtagatacccacctcagacacctccgtttactctctttgaggctgttgttttatcattgattctgaagcgcgcatgggaagaga
attgcttctcgtggtggcacacgttgcagcaaaaccagcaacaatcgactaagtgtcatgttcacctggcatctttgatttccccgccaaatgagacatc
cagaccatcccatacacatattgaagatgaagatttgctatctcataaatgaatatccagtcatacccgattcggtggcgtcatcacctctcttgagtga
cacctgtgggatcatcatcctgtccaagacgatataagtacattctagatccatactcaactgaagttatatcgatttcaccaggttgcaaaaacgagtg
ctgaatccatgccgcttcgctctgtgccgctacaagaaacagccaacgcagtcagacggcaaaagcgctcccatcattggcagtgtcactcgagaaaccc
cctccgcagcagcagagccctccctcatccttcttctttattgcaccaagaactactatgaactacctgttcgggtacggagaaacgccagcagtcgaag
agcaggtgaagcctgaggagcctgcgtaccctaccgccaacgacgtggacttcgaagcgtatggaaaggagaacattcagattctgctcaaccgccacac
tggagacgacaaagtaaccacgtgggagattgtggaagacacggatggtgtgcagatctggcgtggagcagtcgaggagtgcgactggtgtccgttccgt
gccgctcgccgcattgatgccgacaaaagagcaattgagaaggttctgctggacccgaaccgcacactggagctggacgagatgatggagggtattgtca
ctttgcgcgacattggcgagtccaaccacttggccttccgtcaaattaccagcaaggggcagttccctatctacggccgtgagttcgtggtggtcacgta
tgctaccaccctggaggatggccgagttgtcattgccactcgctccgtcaacgtggcggaagttgcccctctcgagggctacgtacgtgccaacaactac
atttcgggttacatcatcgaggagttcaaggaggagggcaaggtgttctgcgtcgtgactctcctggcccacgccgatctggcgggctacatcccaccca
gcatcatcaacatgcttggtacgtcgtcaacggtcaaggtcctcgagaacttggaggcgatcgtaactgacaccagtagttagacccaacatgaggatgg
aagcatctcgtgtaaccaacgtacaagaagcagactatgttttgcagtaaaacaactgcgcttcataacttcacgtcacgaatatacatttttggaaagc
tatgggactcatgaatattcagtcttggtcatcgtctgaatgatgaaagtgctgctgcacaactaaataaagaaggacaacttggggttggaaaagtcga
cagtatccatcctgtcagctgagacgacaatcacagccgagtcttgaggggtttttgaagctgcgttatgtcgaggataaaccacgtcgtcatcactttc
atcgccgattacagttggcacaggagttggggcaatagtgaaggccgattcatccgaatccgagtaccggtagatagcgtggagattctttccagcagtt
ctcgcaggtgtcgcgttcgtcgtatgaagctgtttcatcccgtggacaactgaacgtaagctttgtctttgagcttcttccatcttgccattggaagcag
catccgagtgactactctcggagctttcgtgagtgtcactttcacaatcactcacctccattttgagctccactgatagcattgtcgactgtcgattgct
tcggggcatgagagaccacagagagctgagttcacgagtgcgtttccgttcgtctagcttgatgagatcagtgtatttgtcccgcgaaatattggcgact
tcgatcataaatccgtccttggcctcgcgcttgtcggggtcaaaggagttttcatcacgaggtgcacacaacgatacgaccacttcctgcgcactggtag
ttgacactagccctcgactgggtttaacaacgtagcccgactggttcgaggtgcgcaccttaaaggtgaggcaatcactctgacttgagttcacgatgaa
caaggaggttttcccccaaaaacgtggcgcaggtttcacgttgaatgacagcgtatcatccggctgaatgaggtagagcagaggaccaggttcgtacgtc
ggttcacccgctgtcgtgtcagcggaacgcgcagtcagcatcgtatcactgacggagccgctgttcacgctaatactgctaagctcagtgtcacgaaggt
ttctccttgggagcccgtagtctgttgacgaagacagccttgcctccgatctcctatcgactctagaagttgccgattccctcctagcttccggcttgtc
gattggcatcggaggttcgatggtcgtgtggaagctagcgtcgctgtcgaatgatcgctgccgactgcgacaatcttctctcctcacgtcgtcaaactgg
ttgctaaaagaccggctcaatttactcctttcgctgctgcttccactgcgactcaacctggtctccctcgcactcatgctcaggctcctgttctcactgc
gactggatcgatattcctgcgaactcatactggcgttactcatactccgcgagaacattttgttatctcgtgtaacttctgaaggcaaaggaggacgaac
ccctgacgtcgcggcagcaaagcgacagaccatcttgttctccgtaatacagtccttcggtaccttcttccagaattcacgcaacgacgtgctggagttg
gtatccaaaggctccatagcttgctcttctctctcgacgctctgtacaaggaacagttcggacgactggcgcgtcatcaagtcccgtgggtccatcgcac
tcagacgctcgcaggttctagccgtggctgtaatagtgacatgagcactagctccaggcacaaccagcccgtgggtcggtcgcactgtaaaggcatccgg
gttgcgtgtccgcactctgaaaaccacatcgttgaatggcgatagattggtaagcgtgaggatgcagcgtggccgatgatccgtggtcacgtccggtgct
gggaacagcagctcacgtgccggttccagcaacagactcgagtctacgcccacagacgcagtgatcatcctttaccagttgcgctcggtccaatagcgcc
agaagtgaacaatgaggagattgtgaactgctagagagattcacgatggtacgtcagacgtttccacatacaaaaatcaaggttaattgtgttaagtacg
attcagagatgtcgcatacgaaaatataattgtacatcacttggtagatcttgaagaggcgtcatccatcgttgtcaccctccgatattgatgcgcgcta
cttgccattgctccagtgtgcagcgacgctattatagcggtgcgctgtcgctctcacatatagtggcgatggcactttggatacttgcggcttttctgcc
tctgctactggcgtttggatcgcgaggtgagtgcccaaaaattgtttaaaaatctcaagagatgcggaacttgtaacgctctggcagagtttgtcttgac
ggtgaactcctatcgagagcagcctgtggtcacaccgacagaccaagtgttctgcttgttagaaggtacccgaaatgatagtggtcaaccactgactctt
gtgcacacgacgttccccgggattccgaagctttatgcgaatgaaagcttgcgagaagcttcagtaaaggtggcgtatttaaaatcttgcacttactaca
ctactgtagtactgtactcaagtgtttgctactggtggtgaaggcttctacttcggatatcaacattgctgagtcggtgcatctggaaatcgcaatgccg
ctttcgactaatgagattgtccgtcaggctacggtggtagtcgtgttggattatacattgaaggtagcttgctacggttacattagacagttgtagcttt
agtttctgacgttttgttgattttgtcggctacatgtacttgaaggcctacgccaagctcaacatcgacgtgttagctttctacaggcattcgtctccat
ttggtggagatacgctatatgtagatggcgaccttgacttcgttcagcgaaacttactcgaaatcacggataggtacgtgtcttctacaaaaatgctatc
agtagctgctaaaacgagcatttgtttttgcgcacagcatgcagcgcccgtacattgatacacctatcgttaatatgaccaacacaacacaggaaatgct
actgcaatctctcgttagcaggtaccgaacgcgcaactgtaagattctctttcagtgctgtccaacttggcaattccacagcaaaggctgacaaaccgtt
tgttgcatgctgaagacaccgccaattttcacgcatcctatgcggttttatcgtcaaactccaatgtatcagaggaaactcgggttttccgtgtactgat
ggaaatccggacagacgcaaccagcgtcctgtaagtttgcgcgagcctcactgcaatacgaccgctattgtctgaacgcctttcgttgatcacagatata
cccccgaatggccggaaatcgctaaaagtgcttggatacaggtgcgtcctccgttgcatcaatctctggggtctcatcgcactcacaaccactactttcc
caccagtattactgcatgttcgtagccgtctcgacacttaccatgatccttcgcgagtatattttcacccacagggtgcgtcacccgtcaacacttctct
ttctatcatatatcaagctcacaacgtgtttgtaaagctcctccccagtgcctgcgtcattgatgaactaaaagtcaagaatacctagttcaaagtactt
caactatgtcaacgtcagctatttccgttacaaatcaaaattcatatcagttaactgttaaataggcaatacaagtttcacgtcatacagacaaacgatg
agcaaagtggagagcgattccaagacccaagaagaggtggatctagacgacctcctggatggtaaacgcattcgtctacatctatacagacccccgcccc
tctacttattatctgcgttgctgtagacgcgctgtatgacttcgcggacgaggtgagcgccgcacaagcctcggagatgtcaaatgtccaacaggaagcc
gctgctactgccgctgcgacgcaacacaatgaagataacaagttacaagaggttcgaacatctgttattggtcgagaagataccagttatgaggattgac
gatgttataaccgtagaatatggccaagttcctcgaggacgcacagaatccagagttccagaaggtcctggagcaagcgtttcgagaattgggcacagac
ggtattcaatagtgtctgtagataatgtgaggagttatgaagatgctg