Description :
From Genome Similarity Track
Location :
Scaffold_20:486344- 491597
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007868Protein of unknown function
Pytul_DAOMBR144PYU1_G007867Protein of unknown function

Sequence
5253 bases(100 bases per row)
TCGAGATGCACTCTAATGGGGCAATTGGTAGCGCGTTTCAAACTGGAAAACAAGGTTTTAAACAGAGCGTACTATGGAGACTCCTAAAGTTGATATTGCC
TGGGGAATATGCAGAGCTCCGTGACCTTTGTACAGTCAGCCTGGCTGAGCTAGGTATTCCAGGGCGAGGGTGTCGTGCTATGCATAACGTCATACATCAC
ATAGGAGCTTACATAGAGAGTCGAGTATACAATGCTACATTATGCAATACAGTATAGCGGGTGGCGTTCTCCATTGCAAATGCACCAACCTCGCCATTTT
GCAGTGTGATGATCATTTCTATACCTCTGCAACACAATGAAACAATCCACCGTTACTTTCCGTTAAAGTACGAGAATACGTTTTTAAGATTCTTTCAGCT
CAATGCAAACATTTGTATGTACCCCATTTCACAGTTTCATCAATTTATGCAGGTCGTGCACGCGTCTTCCCCTGAATAGTGGCCCGTCTCCTTTGCCTTT
GTGGTGAGCAGGCAGCCGTCCCCTTCCTTCCTCCCCCTCGCTCACTGTTCACCTCCCAAGCAAGCGCCCGAAGTCGACACCAACGCACGCAACCATGGCC
GAAGGAAAAGCTGTTAGATGGCACCGTATGCCGTTCGCACAATTCGTGTCCTACGAGGCCTCGCGCCCAATGTTCCGCCCATTCCTGATCGGTGCCGCGT
ACGTTCACCCTCCTCTATAGAGCTCTTCGCTTATGGACGTCTTTATGGCGCATGAAAGGAGACAGGATCACTGCTTGTGATATTAACGCTAGTGGCTTTT
TTGTTTTGTCCCATAATGTGTGCGTCGTATAGCATCTCGTTCGTTGTGTGCGGTATCCTCCCAACTCGTGGTGCTACCCGTACGTTTCCCGTTGCCTCTT
GATGCTTTTTATTGCTGGAGTATTGGAGTCGTATCTGACGGTGTTCTGTGTGTTGTGTGTATGTTGAATTATAACAGAGGAAGACAAGGAGGCCAGTAAG
TTCTGGCAGCGCGTTAACGGCAAGCACTAAACTGCGTCGCCCATTAACAAGTAAAGAGAAGAGAGAGGACGAAGAAGAAAATGCCGAGCAACGAGTCAGC
AAAGGCGCCGCAGCGGCGTCGAGCTTCTTCCCTTTATTTGGAGAAGAGCGTGCGTTCGCGATGCGCTTTTGGCTCGAGTGGATGGCTGCGGTCGTTGAAA
TCAATAAGCAGTTGCTAAATACGACGTGGTCATTTACTTTTTTTTATATCCATGCTTCCTTTTCTATACGAATTTCCATTCTTGCCATTTTGATTTTTCA
TTGTGTCACATCTCACTGCGCAGGCAACGTAAGCCTGCGTACGATCTTCATGCTTCACTTGGATTTGGATTTTTGTTGGATTAGCTACGTCTGGGGAGGA
GGATATCTAGGTTTTGCGTGTACATTTAGCTTTTCACAGTCGCGGCACGCTCTTTCGCAATTAGAATAATCAAAACTATCAGCAGCACTGCCAGGGTGCC
GATGATGGAGATCAGCCAGAAGCTCCATCGAGAAGACTCTTCGTCTTCCAGGCCCTGGCGGTACTTCTGTGCCCAGTTCGGGATGATCATCAAATCGGGG
CGCTGCTTGTACAGCTCCTCTTTCTCCATGGGCGTCAGTCGCCGCATCATGCCCTTAACGAGTTTCTTTCGCTTCTTCTTACTTCGCGGCGTCAACCGGT
CGTTCTTGTAATTCAGGATCGGCTTCCCATTGACCTCCATCAACGACTCGGTTTCCTCATGCGGCTCTTCATCGTCGTAGAACTCTTCGTCCTGATCGAG
CACCTCCTCGTGCCACACAATTCGCTTCTTCTGCTTCTGGTTATTGCTGTTCACGCGCTTGTCCTTGTCAAGCGACGAGTACGCCGAAATGCGCTTCAGC
GCAGGCTTGTGCTTGAACTGGAAATGCTTCCCTTCGCCCTTTGAGGCATCGGGCGAGATCTGCAGCCCATCGCCGTCCGTATCGAGATCGTCGAGTTTCG
ACAGCGGCGACGATCCCGACAGCAAGTCGTACTCTTTCTCGCCCGACGTCACCAATTGCTTCACTTTCGAAATCGACGTGACAAACGCTGAGCTAATGAT
ACCAACCGCCTCGCCGGGGGACATCTTCGCGGCTGGCACCGTCTTCTCGACCTCCAAAAGCGCAAGCTCCTGCAACTCCATCTCCAGCGTCTTGGCTCGA
CTGCGCGCGATCTCCACTGCACGTCGTGAAACTTCGGGCGAGAAAAGCGTCGGATCATAGTCGCGGAAATATTCTTCTTCCTCTTCTTGCTTTGGCACAC
GAAGAAGAGGCAGTGTCGGGTGCACGGGGCGTCCATTTGCCACGGGTTTCCGGTTCGGATCGACGACCACGACGATCTGTTCGCGCTGCGTGTCGTCGTC
TTCTTTGTCATCCGATTCCACGATCGGGTTCGAGGCGTCGCCGTTCTTCGCAGACTTGGTGCCATTCAGAGATGGGAGCTGCGCTTCGAGGTCATCGGCG
CTGCCGTTGCCATTCGCACGCACCTGGCCATTCGGCGTGTCGTCGTTCAGCGACACGGTCTCTAAAAACATGTCCGTCGACGTCGTCATCGCTCTATGTT
TCTCTCTCGCGTCTTCCTTTTGTCTTCACGTAATATAACAATTCCCCCTTGTTTGCTTCGTAGTTGGAGCTCTTCTCGGCAATGTGGAGCTCTTCAAATT
TTAGAAGAGGGAGCGGGCGAGGGAGAGGAGGAAAAAAGAACCGCGCAGACTCAGACGCGGCGTCCACACTCCGCGGGGCAATCACTGAATAACGATGGCG
CTTGGTGGGAACAGTGCCAATGCGCTCGCAGTACACACGTGCACGTGCACACACGGGAGGACGGACAGAAGGAAGGAAGGAAGCAGGGGATCACAGCGCG
CTTGTTTCGCCGACACTCGCTTTCTTTCTTTGCTTACGCCTCCACTCTCTCTCTCTCTCTCTCGTCCCTGCCTACCTAACCTACCCACGTCGGTCACTCC
CTCGTCCTTCTCTCTCTTGCTTTTTGTATGAGTAAATTATAAACTTCTAAAGTTCAGCCACGTAAACTTCATGACATCCCTAGTCCTAATCACTTTGGGG
AGTGTCGACCATAAGTAAACTAGAATTTAGCATAGTTTCTCTAAATTGGTACAAAGCTACATGTGGATTGAGATTGTTCCTACAATGCGCGCCATAATCT
TACGGACACCAGTTTTTTTCTTGAGATGTTGGATTTTTTTGAGAATTTTTACTCTACAAAGCTGCTTTTTTGTCATGTTGTTGAACACCACAGAGACAAT
TTTGTGTGTTAATTTCAGCTTCATTGGACTTCTTTTAGTCCACAAAAAAAATATTATAAATTTAAAGAGATCGACATAAACATAAGGACAGATGAAAACA
AAGCAGTTTGGGGGCGTTTACGACTGGATTATTGTGCTCACAGGTCCAGCAAGATACGTTAGCGTTTGTACAAATGTATAACATTGTTGATTTTGTCACG
GGGGCGTGACAACGATGCCAAAGTCTCCAAGATTGACCAAGCTCGAACAAGGGAAAATTCTGGCGTATTCAAGCGTGAATATGTCAATTCGGGACATCGT
AAAAGCTGTTGGACGCTCGAAGAGTATTGTACATGCCTTCTTGAAAACCCCCGAGGGCTATGGGACCAAGAAAAGCCCCGGGCGACCACGTCTGTTGAAG
ATTCACGACCGCACCCGATTGAGAAGGTACGCAGCAACTGGTAATTACACGCAAGCTGTAATGGGCTAAGGCTGCCATTACATGCAAGGTGGCTCTTTGT
GTGTGTCACACGCCACCTTGTGGATGTGCATTGTGGGTGCGAAGATATTGGGTGAAACACATAAAAGTGATTCCACATGCACAGGTGACGTCATCGTCTG
ATGTCAGAGCAATCTGTGTCTGAGTTGAGTGTTGATCGCTCGCTATCATTGAGATTCGGCGTGATTACGCACAACAGTACTCTAGACATGTGAATGATGG
TTCCCACTTTGGGAAACCACACTGGTGACGAGGCCAACGTGTCTCTACCATCTGAAGTGAGTGGCTTCCGCCAATCACTTTGCAGGGAATCTCCGCGGTA
CTTCAAGTTCAAGTTTCCAGCAGATCCCCTGGGTTCAACCTCAGTGTACCCAAGGTTTTATATATCAGACTCATAGGTTTTATTTCTGCATGTGTAGGTT
TTAGTTGTAAAACCTCTAGGAGCCCTAGTGGTGTTTCATATGTAGTGTCAAGAACCATAAACTCATTTCAATTCAGTTGCATTTTTGCCAAGTTCCTCTC
AAGTCTTCCTCTCAAGCGCAAGCGTGCGTGCTGTGTTTGAGGCTGTCTCGGATAGCCTCTTACACAAGCCAGCTTCGCCAGAAGCTAAATATCAATGCAA
GCATCCGCACGGTGCAACGCGAGCTTCAACGGTGTGACTATCTTGCGTTTGAGGAGGCCAACAAATCTCCGTGCATGACCACCTACCACAAGATGATGCG
CGTGGCGTGGATTGAGCGTCAGATACGCTTGCGCACAGACTGGAGCCGAGTGGTGTTCTCGGGCGAGAAAAAGTTCAACCTGGATGGTCTGGATGGTTGC
AAGTACTGCTGGCACGACTTGAGAAACGACAAAAAGATTATGTGGAGCCGTCATTCCGGTGGTGGATCCGTTATGTTGTGGGGTGGGATGTCATCGCTTG
GAAAGACTCGACTAGCTTTTTTCGAGGGAAACCAAGATGCGTTTGACTACCAACAGACGCTCACTACCCACCTCTTTGAGTTTGTTGATGGTGTTCATGA
AGGAGACTACGTATTCCAGCACGACAACGCCAGCATTCACCGGGCTCGTGCGACGAAGAACTTCCTGGTGGACCTCAGCATTCCCACCATAGACTGGCCA
TCGCTCTCTCCTGATATGAATCCTATTGAAACCTATGGGGATCATGGCACGTCGTGTNNNNNNNNNNNNNNNNNNNNAAGTACCGCGGAGATTCCTGCAA
AGTGATTGGCGGAAGCCACTCACTTCAGATGGTAGAGACACGTTGGCCTCGTCACCAGTGTGGTTTCCCAAAGTAGGAACCATCATTCACATGTCTAGAG
TACTGTCGTGCGTAATCACGCCGAATCTCAATGATTGCGAGCGATCAACACTCAACTCAGACACAGATTGCTCTGACATCAGACGATGGCGTCAACTGTG
CATATGGGATCACTTTTATGCGTTTCACTCAATATCTTCGCACCCACAATGCA