Description :
From Genome Similarity Track
Location :
Scaffold_19:48630- 49736
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10185cation Diffusion Facilitator (CDF) family
Phypa_INRA-310PPTG_10186hypothetical protein

Sequence
1106 bases(100 bases per row)
GTATACTATAGCAAAAAGAGGCGATCACGTTTACCAAAATAAGTTGAGAAATGGCTTCGAGTAGCAGTTATAGTGGGGGACGACCATTGATACAGGCTTA
AGCTGGTCGACCTGACTTCGCCTCCATTTCGATGCATATGCTTCGAATGATCACTCATTCCACTGCAACCGTGGCAGTGCCACAGAACGTCGCCGCCTGT
CACTAGATGTTCGGAGTCAAGTCCACCGTTATTATGGCGTGACAAAGCAAAGTGGTCAGAGATGTCCTGACGGCTTAAATGTTGTTCAGAAACACCTTCC
CAGCTGCAGTCGCGTGTGTGGCGGCTGTACCTCCAACTGATGCCTGCTGTCAATGACGATTCTTCGCGCCGTTCAAACAGCGAGAAATGACTGATCACCT
CACACGTTATTTGTCCAACACCATGATGTGAATCCAGAGGTGGCAGCAAAACTCGGCGAGTGGATGGAAGGACAAGTATCACGGATCGAGCTAGCAGTGT
CTCTTCTGAGTTTTGCCAAGGCGACACGAAAACTTTGGTCCCAATCATTCCTCAATTTGCCATCAACCAACAACACCTACAGCGCCAACACACTCGCAAC
CATGCAACTCATTCACTCCACTGTCATCGCTGCTGCCGTCACGGCCGCACTCGCCTTCAACTCCGCTGACGCTCACGGATACGTGTCCAAACCGGCTGCT
CAGTTCGTTGACCCGTCATCCTCGACCAAATACGTCAAGACCATTACAGCCGACGTCAATAGTGCCTTTGGAGGCCTCAAGTGGGACGACAGCCCGGAGG
CGAACGCGGCGACGTTCACCTCGTCGTTCGCTAATGCCGGTTACTCTTCGCTGCGCGATATGCTGGACCAGCAGGTCACGGACTGCGCTAACACCCGAAC
TGACGTCTCACCAGTCGATGTCTCGGGTCTCAGTGTCATGAACTGGCAGAACGACCAGGAGCAGAAAGGATTCATCGACTCGCACCACGGTCCGTGCGAG
GTTTGGATCGACGACACTATGGTGGACCACCAGGACGATTGTGTTGCGGCCTACGGCACCGGATACCCCGCCAGCGTCAAAGCCGACTTCTCCAAGTGCT
CGGGTG