Description :
From Genome Similarity Track
Location :
Scaffold_1073:4863- 9747
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1073-snap-gene-0.6Protein phosphatase 2C
Pytir_DAOMBR486maker-pir_contig_1073-fgenesh-gene-0.1Myosin

Sequence
4884 bases(100 bases per row)
GTCGGCTGCAATGCACCTTTCACGTAACACGAGTCTGGGTGGCGACACGTGAACGCATTCGCCTCGCTCGGGTGCTCCTTCTTGAGCTTCTCCTGCTCCG
ACTTGACCATCGCGTTCTGGTCGTTACTGAGCGGTATGGCGATCATCTTGTCCTTGTTTGCAGGGTCCGTCTTGCCCAGCACCGCTCGAATATCGCCAGC
TGCAATAGAAGGTGAAGGAAAGTGAGAACCAATGCGACTCTAAGAGAATATGAAGCACAAAACATGCCACATACCGTTCGCAACGTGGAGGTAGTCCTCG
TGTACGAGCGTGAACAGCGCGCACGATCCACAACGCGCAAGCGCGCCAAACCCCAACTTGAACGCCGGCAACACCTGCGCCATCAACTCGCGATCTGTGC
GGCCGAACGCGCGCTGAATCGCAGCAGCGACTTTCTTTGGAGACGCTGGCTTCTCGTGCTCACGCTCGGGGTCCTTGAACGCGTGCCCAAGCTCCTTCTG
GATATTGCCAATCAGCGTCTTGCTCACGTACTCGGACACCTGCCATCCGCCTAATAAGTAGCAAAGCGCGTACGCACACACACATTACAAGAAACATCAG
TATGTTTAGCCACTCAGCAATAGTAACATGTGGTGATAATGACAACACACTCATCACAATTCACGCACCATGTCCATCAAAGACCGCGGCGTACACATCT
CCGTTTGAAGTGGACTGGACGTCGAAGCGGTCTTCGATCGGCGCATTCGCCTTGTACGTCGCACAGCTGAAGCGCTTTGCAAGCGACTTCTCGAGCTTCT
CAAAGCGTTCACCGTCGAGCGGCAGCGTGAACCCGCCGAGATCGAGGTCCGGGTCTCCACTGTACGCCGGTGTGTACCGCGCATCGCACTGCGCCGCAGA
GGAAACAGACGATCCAGCGCCGCCAGCGTCTCCGTGCGCGAGTGCGAACACCGACAAGCCGATGCCGCTGATCAAGAGCGCTTGGCGAATCGAGCCCGCG
AGTTTCTTCGTGTTGCTCTACAACAATACAGGAGTACAACAGAGTGATGCATAGCATAGCGCATGAGCAATGCCGAACGACTCAGCAAGGTGATAAGCAT
TATGGCATGAGTCAGCGCTGTCTTTCGATATTCTTTCTCGCTTTCTCGCTTTCTCGCTTTCTCTGCACTCGTGAAAGAGCGAAGAGCTACGCAAGTGGAC
AAGTGCAGTGGCAAATGGGGTCCACACCCACATCGTCGATGAGAAGAAGCCCATCTCGCCGCGTGCGCCAGCCGTGCGCAACGAGCCAAGAGGGAGGAGT
CTGACTCACCTGCTGCTGCTGGCTTCCTCCGCGCAGCAGACGCGCGATCCTGAGTGCGTTGGCTGCCCGCATCCTCACTTGTTGTGCTTCAATCTCAACA
GCGAAGAAGGAAGGGAAGGAAGAAATAGGGAGTCAATTAGTCACTTGATCAGCCAGCTGGCAAAGATACTGTGCAAGCTCCGATTAGGTACGAAATCCGA
AGAAGTACGAGCTCGATTTGATGTGCGTACCTAAAGAGGCCGATACAGTAGTGGCAAATGGTCCCATCCCAGCTTCAACCTTGCGCTTTTTTCGATCTTC
ATTCTTTTCGTCACACGTCACAGATATTCGAGCCTCGATTTCTCATACATCACAGTAACAACATGTGGGCAAAAAAGCGATGGGACGAAATAGACAAAAG
GTTTTGCGTTGTGCTTGCCTTGACCGGTGTGGCGGTTTCTATTCTTGCTGGCAAGCGGTGCGTTGTGTTATATGCAATTGCGATGCAGCTCGTTCTGTGA
AGAACATCCACACGCGCGCGCGGCGTTGTGCCTAAACACCCACTCAAGTACTTGTACCATTACTGGACACTTCGCTTCCAAGAGGCTCGTGGCGGCTCGT
GGCGCTTANNNNNNNNNNNNNNNNNNNNGAGCTTTTCGCCTCTTGACTCGTTGTTGTTCTAGTGGGTTTTTCTTCGTGAGCACACGCATTTGAAGTCTTG
GCTCTTGTTTCACGAACAAAAGCGAATGATAGAAAGAGCCGCAACCACGCACCGTGAACGGATGCGCTGTGGCTATTTGCCTATTGTGTGGCATGCTCGC
ACCTCAAGTGTTTTCTGTAGTGTGGGCAAGTTTGAAAAGTAGTGGCGCATGGTTGACTCAAGCATTATGTCAACATGACAAAATTTTAAAAGACGTGGTG
TGTGAAAGGGCGGTCGGCTTTGAAGCAGGGGGCTGCTGGTTGTCTTTCTATCCATCGATTACTAGAAAACAGGGACACAGCGCTTTGTGGCAGTGTCCTT
CCATGATGGAACTTTGTTTAGTGCGCGGCCCTTGCGTCACTCGGCACTCGAGGTCCACTCTTCAATATCCGCCAGTCAGCCAGCACACAGGGTTTCTCTG
CGATGTTGATGATGGCGATGGAGTCAGCGAGCTGGGCCTGACTTGTTTTTCTGACATCATGGTGAGCTATTTTTGGTCAGGAGCTCCTGAACAACAAGTT
GTGTGTGTGGAAATCATCCAAATGGGAAAGCGGACGGACGGCCCACAGTCGTTTCTCGTTGGGAAACACCAGCGGATCCTTTTTTCCGTTATGTTTTCTT
CTATGGCTTCTTTCGAATTACTACTGAGTTGGGTATTGTTCCAAAGCGAGAGCGAGGTGCTGACTTTCTCTGGGCTCACCCCTACATTTCCCTTTTTCGG
TCTCACGCGGTGCCTCGATCCATCGAACCTCTCACGCGCGCGTGTTTGCTTCTCTTGTTCGAATTTGCGGCCGATTCGAAGTATTATTGTACCGAAATCC
GTATTTCTTCCAAGGCGACCGGTTCCCCATTTCTTTCTTCTGCGGATCACCTGTCGTGGGGAGCAGTCTCTCTGTGGAAGCCAACAGCAGCAGCAAAGGA
CACGAGCAAGAGCTCCTCCCCATTCCCAAACTTGCAGGCTTCTCGATCCATCCGCAGCTTTCTGCCTTCCTCTGTCCTGTCGTGTCTGGCCTGAACGAGC
GTGAACATTCATTCATTTGTCCATCCAGTCAGTCAGCCATTATCCATCTCGCCACCAAGAGCTCATCACAGACCACAGGAACAGGAACACAAGCCACGCA
TCAGGAAGAAAGATGATCAAGGACGCGCCGCGCCAGAATGGCGAGTTCCTCGTGCAGCACCTCGTGGACCCAACCGACTGGGTCTCGGATAACGAGCGCA
CGCTCTGCAACGTGTGCACGCGCCAGTTCAGCACGTTCCGCCGCAAGCACCACTGCCGCATGGTGCGTAGCTCTTCGTATTTGACTTTTGACTTACTTTT
TGTAGGCCATGCCTCCCACGGATCTCTAACCTATTTATTGCTGTTGTGTTGCAATAACAGTGCGGCGAAATTGTGTGCAGCAACTGCACGCTGCTCAAGA
GCGCGCTGCTCGCAACCATCGGGTACACGCGCGTGCGCGTGTGCGTCTCGTGCGTCTTCAACCACGCGCACTCACAGAAAGTGCATGCGCCAGCGTCCCA
CAACTACATCAACCACATGAACAACAACGACAGCATCAGCTTCACGCCTACGGACGCAACCACAACAGAAGAGTCGCGCCAGTGGCTGAGCAGCCACCTG
CACTCTCCGCTCTCCAAGTCGGACGAAGAGGACTACGACACGGAGGAGTACGGCTCGGGCGACAGCTTTGAGAACAACAACAACTATGGCAACAACGGCA
ACAACGGCAACAATGAGTACCAGTACCAGTACCAGTACCACCAGCAGCAGCGCCGCCACAGAAGTCCAAGCAGCAACAACAACCAGACCCCATCTCCGCA
GAAGCCGCAGCCGAGTCCAAGCTATCACAGCAACAACCAGCGAGACGCCGCGGCGCCGCCATCTTCTTCTTCCTCCTCTTCGTGGTCGCACCCGTGGCCC
AAGCCGCCGGTCGCCGCCGACGAAGTTAGTCGCCTGCACGCGCTCCACGCGCTCGACGTGCTGGACAGTGATCCGGAGAAACCATACGACATGATCTGCG
ACCTGGCCAAGGCGCGGCTCTCGTGCCCCATGGCGGCCGTGAGCTTCATGGATGAGCGCCGCCAGTGGTTCAAGGCCAGCGTCGGCCTGGCGCATAAGAT
GATCCCGCGCAAGATCGCATTCTGTGCGTACACGGTGTTCACAAAAGAGCCCGTCGTGGTGCTGGACACGCTTAAGGACAAGCGCTTTGACTGCAACCCG
CTGGTCTCTGGCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTGCGCTTCTACGCGGCTGCGCCGATCATCGACCCATCGAGCGGCCACGCCGTCGGA
AGTGTGTTCGTGCTCGATACGCGGCCGCGCGAGTCCTGCGACGTCGCGATCCTCGAGCGCCTCGCCCACGCGGCCAGTGAGAACCTGCCGCAGCGAGAGG
AGAGTCCGGAGCAGCAGTCGCAGCAGTTCGAGAGCTGTTACGCACCGGTGTCGCCGCTCTCGCCCGCGCCGTCGACCTCCTCGCTGTCGTCCGTTCCGTC
GTCGTCCTCCTCCTCCACTGCTGTGTCACCAATGAGCAACAACTGCACTGGCAAGGCGTCCGCCGTGCGATCACCCACGTCGCCGGCATCGCCCAACAAC
AACTCAGTGCTGTCGGCCATGCTATCGACTGCCACCACGACCAGCAGCAACGGCAACAGCGGCGCGGTCGCGATCGCGAGCGCCGAGCAGATGGAGATGC
TCTTGATGCGCCTGCTGACGCAGAACACAGAGACGCAGCAGCAGCTGGCCACACAGCAGATTTCAATCTCCAACACCATCGGCTTCCACTCGACCCAGAT
CAACAAGCTCATGACCGACTTTGCGCGCATGGAGGTGAAGATCGAGGCCAAGATCAAGTGAGCGACAGACAGTGTGGTGTGTCT