Description :
From Genome Similarity Track
Location :
Scaffold_410:4862- 8203
Transcript NameFunction/comments
Phypl_g7996pectin lyase, putative
Phypl_g7997hypothetical protein PHYSODRAFT_335251
Phypl_g7998hypothetical protein

Sequence
3341 bases(100 bases per row)
GGCACGACCACTGAGGTCGGTTGCCGACCAGGCTACACGCGCGAATGCATGGCCCAGAACAACGGCTTCAAAAGCCAGGACGTCATCCTGCAGAGTGGAG
GAATGAACAATACGGGTGGCTGCACCAACGGCACGGAGGTGGAGTTGACGTACGACAACGCTGCTATTAAGCGCATGAACGTGCAAGCCAACAAGACCGT
GCGCGGACTTGGCAAGAGCGGTGTGATCATGGGCAAGGGCTTGACGCTGAACGGCGACAACATTATCCTGCAGAACATCCACATCACGGAGCTCAACCCG
CACGTGGTCTGGGGCGGTGACGCGATATTTATGCAGGGCTCCAACAAGGGCAACACGACGCTCAACAACATTTGGCTCGACCACGTGAAGGTCTCTCGCG
TCGGCCGTCAAATGGTCGTCACGAACAAAGCCGGCGTTTCCACGATGACCATCAGTAACTCGGACTTCGACGGAAACACCGAGTACTCCTCCACGTGCGA
CGGCCACCACTACTGGACCTTCCTCTTCTACGGCAAGAACACCGGCGTGAGCATGCTCAACAACTACGTGCACGGCACCTCGGGTCGCTCTCCTAAGGTT
GGCGGCAACAAGAatgagcacgtcgtcgtgcacaTCGCTAACAACTACTGGGGCAACAACTCGGGCCACTCGTTCGAAATCGGTGCCAACTCTTACGTCC
TCGCCGAGGGCAACTACATTGACAACACGAAGCTGCCTCTGTACAAGGGCACGGACGGGTCCATGTACGCTTCCAACGGCACGGACGCTGCTGATGTGTG
CACGAGCTACCTGGGCCGTCAGTGCGCGGCGAACGTtctcttgagcagcggcaacttCACGTCGCGCAACGCCCCGGATGCTCTTGAGGGGCTCAAGGCG
TACCCTATCATCACTGGCTACTCGTCCAACGCCGCTCAGGCCAGCGGCTCGGTGCAGCAGTCGTCTCAgtcgagcgactcggagcagcagcaggggcAGC
AGTACACCCCTGGCACTGCCAAGCCGTCGGGCGAGACGATTCAGGCGAGCGACTTGGCCAAGGAATGGGCCGCGACGGCAGACAACTTCGGCGTCGGCAA
GCTCGATTAGAGACGCTGCGTGCAGTACCGTGTAAAGCATCCGTGATGCATAGAATACAAATGTTAATGTTGAGGGCAGCCCAGCTACTCAAAAGTCAAA
GATGGCGCCCACTGATGCCTTTTTGAAGAATGTCATTCCAGTCCTGCAAAAAGGGGTCAATCGCAAGCTAACCAGGAATTGCATCTGTCACAGATGACAA
CTGCTGTGGTGCGTTCCAGCGACAACACTGTGTGAATGACTAAGTTTGCACGCCTCAAAACCAGTGCGTATCCGGATATAACTGGCACCTTGCACTACAA
CGGTCGTTATCCCTCGCATGCATCATTCATTGCGCTTGTTCATGTTGCACCCGTTTACTTCTCTCAATATCCACCTGTCTTTCCCACACTATCGCCAAGT
TCGTTCACTGAAGTATTAGTTCCTACGCAAATGAACCAACACCTTTACCAGGATGCAAAAGGAGTCGCTGTGCTCCCGGGTGCTGCTTACACTAGGAAGC
AGTATCCGGGTGTTGtgagtacatgtactaccAGATTGGTACGAGCAATGTGCATCTGAATAGATGTCTCTCACTCCCAATCTCGCCGCCTAGCAGACAC
TTAGAGTACAGGATATCGGTATCATGAAGGTCTCGTACATACTCGAGGGGCTGCCGCTGCTACTATCTGCAGGCTTGGTGGCCGGCTACGCCAACCCCGA
GACCTGCACTGGCACTTGCACCAACGCGCACGACCCGTCCATCATCCGCAGGTTCGACGGGACGTACTTCCGCTTCTCCACGGGCAACAAAATCGCTGTG
CACTCGGCCCCGGACATCGTCGGCCCGTGGACGTACTTGGGTGCGGCCGTGCCCGATGGCTCCATCATTGACTtggacggcaacgacgaTCTCTGGGTAA
CAAACACGTTGGCATGAAGTGAAGAGATGTAGGTAGGGCACTAACGATTTTGCACGTACATCTGAAGGCACCGGACGTCCACCTCGTTGGTGATGAGTAC
TATCTGTACTATTCTGTGAGCACGTTTGGCTCCCAGAGTTCGGCGATTGGACTCACGCGCTCGTCCACTATGGACATGGACACGTGGACGGACTACGGCA
GCACGGGTGTTaccagcacgtcggcgaAGTCTTACAATGCCATTGACCCGAACCtcatcgacgtcgacggcacgTATTACCTCAACTTCGGAAGCTACTG
GCAGGACATTTTCCAGGTCGAGAtgacgtccacgtccacgaagtCGACGGGCGCGGCCTCTCAAATCGCCTTCACATCAGActacgaggtgctggagggA
TCGTACATGTTCCAGCACGGGGACTACTACTACCTGTTCCTGTCAAAAGGTCAGTGCTGCAGCTACGACACGTCCAAACCGGCTTCGGGCAAGGAGTACC
GCATCCTCGTGTGCCGTTCATCGACTGCGACCGGCAATTTCGTGGACCAAGACGGAACGGCCTGCACCAATGGCGGAGGTACCATCGTTCTGGAGTCGCA
TGACGAGGTGTACGGACCTGGTGGTCAGGGCGTGTACGATGACCCTACCTACGGTCCTGTCCTGTACTACCACTACGGTGAGCATGTGGGGCGGTGGCAA
TCCTGATATCCTGCTATTGTAGCTGGTAGTCTGACGATTTGCTGTGTATTATCATGTTGTAGTGAACACGACGATTGGTTACGCGGACGGTGACAAGCGC
TTCGGATGGAACTGCCTGGACTTTTCTAGCGGTTGGCCAACTGTGTAAGCATTCGGGACCCCAACCGAGGTCAGCCCTATGTGTATGCAGTTGTTAGAGT
TGAACAGTAAAATACTAAGCGAGCTTCGCTTCAGTTCGATGTGCGAGCCAGCAATGAAAAGCATTCCTGTTTGATCGAAAAAATGTTTACTTTGAAGTAT
CAGTGCTATACTTCCGAATTCGACATGGAGACACGTAAAACTGCGCCTGACACTCCGAATTGGAGTGATCACCGAGATAGTAGGGTGGTGGTGTTATCGA
GGCTATTGAATTACTTTGTCACAGTCTCGCGGGAATTCTACAACTTGACGGACGGCCGTAGCTTGCAATCGAGTGAAAGGAAATGTATTCCATTTGGTAG
CACTCTTAATACCAACGGCGTTGATGCCTGGAACGTCATGCGGTTCCGTTGGGTTTGTAAACCCGTTTACACAACAGGCCAGCCGCTCGAGAAATCCATC
GTGTTCCAGCCCAAGCGCTTGTCACCGTCGGCGTATCCAAC