Description :
From Genome Similarity Track
Location :
contig_39:486182- 487552
Transcript NameFunction/comments
g8629.t1hypothetical protein

Sequence
1370 bases(100 bases per row)
CGATGCAGTACGGATGGTCGACGTCCCAGCTCAACTACTCCAAGTTCAACAAGGAGAAAGACTGCAACGCTCGCCCCGTCGCCAATGGCACGTGCACCAT
GTTCCCTGGACACTCTAAGGCGGAGTGGACGGTCGTTGTCAATGCCTGGGTGTTTGGTGGAATGATCGGGGCTCTCTTGGTCGGCAAGATTTCGGATCAA
GTAGGACGCAAGCGAGCGCTGATGTACAACTGCGGCTTCATCATCGCTGGCGCTACGATCCAGGCAGCGGTGTCCAACATTTGGGCGTTCGCGTTCGGTC
GTCTCTTAGCTGGGATTGCGTCGGGAGCTAGCACCGGATGCGTGGGGACCTACATCAACGAGATTGCGCCTCCTCACCTTCGCTCGAAGCTCGGCATCGG
CCTTCAGGGTGGAATCAACCTCGGCATTGTGCTGGTCGACACCACGCACTTCTACCTGGGCTTTGACCAAGGCTGGCGGATTATCGCCGGCTTCCCCATC
GTGTTAGGAACGCTGTTTTGGCTCTGTCCCATTTCGTCATGGTCGAGTCTCCAGTGTGGCTGCTGCTCCACGGACACCGCAAGGAGGGCGAGCAGGTGCT
CGTTCGGCTCTACGGTGAAGAGAACGTCAACACCGCACTGTCCTGGATCAAGCCGGAGAAGAAAGCGGTGGATGTGGAGAAGCAGACCCCGTGCTGGAGT
GAGGTTGGCCACGAGACTGTGATCAAGGGCAAAGGTCTCACCTGGGGCGAGCTGTTTGCAGTCGAGATGCGCAGACCGCTGGTGGTCGGCATGGGGCTCG
CATGCATGCAGAAGCTCACGGGTATCAACTCCATCTTCTACTACTCGTCCAGCCTGTTCGGCGGCGTTGGTGTCGCGGACGGCCGTGTCTGCAACATCAT
CGTGGCTATCGTCAACCTCATCCCGACGCTGTGCTCGGGTATGATCTCGGCCAAGTTCGGCAACCGCCCGATGATCCTCTTCAGTACGGTCGGCATGTGC
GTCAGTGCCGTCGGGATCACGCTGTCCCTCGCGTTCGACGCGCCGCAAGCGACGGTCGCTCTTGCTGCTGCCTTCGTCTTCTCGTTCGCTATCTGCCTCG
GCCCAATCATGTTCGTGGTCGTCGCTGCCGTCGTCCCGGATCACGCTCGCGGCTCGGTCGTGTCCATTGGCATTTTCGTTGCCTGGGCCGCCAACCTGCT
CGTCGGCATCGGCTACCCTTACATGGCCACGGCGCTGGACACGTACAAGTATGTCCCGTTCGCGGTCATTTCCGCACTCTCGACCGTCTTCGTGTACTAC
CTGGTCCCGGAGACGTCGAACTTGACGACTGCCGAGATCCAGGACGTGTTCAAGAAGATCCGCGGCAATG