Description :
From Genome Similarity Track
Location :
Scaffold_14:48610- 52645
Transcript NameFunction/comments
g1141.t1XP_024581804.1 zinc finger protein [Plasmopara halstedii
g1142.t1RAW40020.1 hypothetical protein PC110_g3718 [Phytophthora cactorum

Sequence
4035 bases(100 bases per row)
ATGGGCAAAAAGAAGCGGCGCGACGACGGCGCGGGCGGCGAGGCTCCGGCGCGACGCATCTTCTGCTACTACTGCGACCGCAACTTCGATGACGAGAAGG
TGCTGATCCTGCACCAGAAGGCGCGCCACTTCAAGTGCCCTACGTGCCACAAGCGGCTCAGCACCATCAGCGGGATGATCATCCACACCCAGCAGGTGCA
CAAGGAGGCGCTCCAAGGCGTCCCGAATGCCAAGCCAGGCAGGGAGAGCCCGGACGTCGAGGTCTACGGCATGGAAGGCGTGCCAGGTGAGGCTTTCCTA
ATAAGCTGTAAATGGCCGAAACCTTTAATTAATCTGCTGTATTGTTATTCAGAGGCTGATGGAGGAGTGACCAAGAAACCTCGGTTAGATGCGCCAGGTC
CGCCTATGATGGGCGGCTTTTCCGGTCGAGGCATGCCGCTTCCGCCGTTTATGGGCGGTAGACCGATGCAATATCCAGGTGGGATGGCTCCTCCGGGTGC
TGGTATGATGCCGATGCGTCCTCCGCCGCCGGGTATTGGAGGTGCAATTCCCCCACCTCCGCCGAGAGGGTTCCCTGGTGGTGTCATGCCGCCTCCTAGA
ATGGTGGCACCACAAGGCTATCCGCCGTACGGTGGAGTGCCGCAACAGTGGGCTAGAGGGCCACCGCCTCCTGGCACTGCGGTGCCTTCACTGCAACCTG
GCGCTCCGTACATGAATCAGCAAGTGTTGCAGGCTGGTTTAACACCGCCGGGGGGTGGAGCAAGAGCGCCGCCTCAGGCTGCAACAGTCAGCAATACGAA
CATGTTCAATGGCGCTGCACAGAAAGAGGTAAAAAACGACCATGGCCTTGTGTATACTGACGAGAGCACATCGATGGTACGTGTGAACAAGTCGATATGC
AGGTTTTGTTTTGTTAATCTGACGGGTGTGGTGATTTGACTCATTGTTTAGGAGGAAAAGCGTGCACTCCGACCGAAGTACGCGTACAAGCCACTGGGGG
AAACTGGCGCAATGGCTTGAATGGCTTGAAACAAGTAACATATCCAGAACGAAGACAATCGAGCCTCCTCGTTTGGAATTATATCATCAAGTGAGCCTAA
CATAGTTGGCTTGATTCGGTGACCGACGGATGTATGGTACGATCTGCTTTCGATTTGGGTTGGTTGCACATGATCAAGGGTTAAAGAAAGATTCATTTTC
CTCACTCACTACATAGTTGTTCACGGTTGGCCCCCGCTGCTGTCGCCTCAGCCAAGGCGTTTTGTCCCTGGGAGCGGCGCCTATGTGAGTTATGTGCTAG
TAGTTTGTTTACCTCTCTCCTTTGTGTTTCTTATGTGCTGTTTCATTTGGTATAGCACGGTACGGTGAATACGTGGAAATACGCGGGTGTCGCGTCGCCT
ACAAATCCGGGTAGCCGCCGTACTTGGAGCAATAACTCTTGAAGGACGCCGACACTGGGCTGGGAATCTGTTCCAGATCATTCTCCTGCTCGTTGTTGTC
ATCGGTCGTGTTGTTACCGACTTGCATGTCTGGCTCCACGTTGGCCTGACTCCAATTCATTGTCGGGGCAGGCACGCTGATCTCCATCCTGGTTGGTCGA
GGACTCCTACACAAGCTGCTGGTGCTACCAGTGAATGAAGGCGGTCCTTGGGGAGCCTGGTTATCGGCGTTGGTAGCTGCAGCTGTAGACATGGACCCAC
CCATCGACTGGAAAGCTGCGAGATTGAATGCTCGCCTCGAGGCACCATAACTACCGTCATCTCCAGATGCACTACCCATACTGCCAACAGACCTGCTGTG
GCCCCTCCAGCGACTTAGCATATTGTTGCGTCCGAGCGAGTTATTGCGGCCGATTGAGTTGCTGTTACCAGGAAAGTAGCGCGATCCGCTGGGCCTCGCA
GTGACGGAAGATGCTGGGGAGTCGTAAATGCGAAGAAACACGTTTGTTGGAGAAGCCACGGAGTCGCGCTGTCCAGCGATTTGGTCAGACGAGTCTGACG
GGATAACTGAGCCGAGTGGTGGGGTAACAAGGCCGAGCGGTGGCGTCACGGGACCAAATGGCGGTGTTGCGGGATGCGGCTGATAGCCTTCGCCTTCTGT
GTAGTGACTTCTCAGGAACGATCGACGCATGATTCGCGTGTGTGTTTTCACCTCTTCTTGAGTTACGTTGCGATGCATTCCTTCCTCGTCACCGTTGCTG
GCGTTGAGATCCACAAAAATACCCGTGAGGCTCATGACCAGCACGAGGCTGGGCATCGTCAGAGGCGTGATAACGAAAAGAGATAATACCGGAAATATCA
CCATGAGAACCAACAGCGCCGATCGACTTGCTGGGGAGAATGACGAGTTCGAAACGCTGTTGATTTCTACCAGCGAAAGCCACACCAGGTAGAAGGCTTG
TCCGATCGTGGCAAACTGAAAGAGTCGAAGCAGCAACTTGGGGCTGTTGAACCAGAACTGGTCATCGTGGTAGTGTAGCTGCCTGTGACAAAGTGCAGAC
ATCTGCATACGAATCATCGCGCGGACGGCAAGTGCTGCAGCCTTGAACTTCATAGCACTCTTCTTGCGATGGGTCTGCAATAAGCTTTGAAGATCTTCAG
CAGAATTCTCCTCCGTTGACTCCTCGGCTGAAGGTGGTATCGACTCGGAAGCGGAGGCATTATTATTGTTGTGATGCCAGCGTTTGCGAACTCGATTGCG
CCCTCCCGGGGTTTTGATCACCTTGTTAAGCCGCGCTTGGATATCTCTCGTCGTGATAATGCGTAGACGGTCGTCTACGATGCCGCGCAGGATCTTCAGC
ACCTTGAAAAAGATGACAATGTTCACCAGCAGTAGCAGTCCGCCCACACCGATGAAGATCCAGTGATCTTGGCCAGGGAACATTGACGGCAGCAGGCAGA
TAACCACGAGGATAATGAATGCGCTTGGATGGATGTTGGTCATGTGGAGAAGCAAGTTGCGCATGCACAGCACATGGTACTTCGCGTACGTCATACGGTC
TTTATCGTCTTCTGCGCCGTCTTCTCCTCCACCTTGCGCTGGCAGATTTGAACGAACGCCAAAAAGCCGCTCCATCTCCGCAGGGTTCTTGTAGATGTAT
CCGCTTCTGTTCTGGCAAATGTTGTACGCCAGGATTTCGAAGCTCTTCCAGAGATTCCATTGCTTGCGCACGTTGAAGTGAAAGCACCACCCTTCGCGTT
GGTATCGCTGAATTAGCAGGCTGTACGCTCGGGTGCCCAAAACAAGGTCCATGCCAGACAGTGCTCTTGTCCTCATGGCCATCGTGCGGTACACGCCGTC
TCCATCCGAGCGCTGGCGGGCTCGCATGGCGATATAGTAGTCGTCGGACGGAGTATCGAGCGTGCGTTCCCCATCCTCTATAAAGCTACTGCCGGAGCTG
TACGGGTTGAGATCGCGTGCCAGTGAGGACGCGTCTCGGATGAAGGAGTGGCGCATACGACGTCCATTGGCACCGCAGTCGTCTCGGTCACTGCTACTCC
CGACAATACTGGGGTGTCGAGGGTCGTACGTGTCGTCGTGGATGTCACTGATGCTCTCTCGGCGCTCGTCGGGGTGCTTCTTGATCTCCCAGACGAGCTT
GGGCACGACCGTGCCGATGAAAAGCAGCAGCAGTACAATGACGATAAAGTAGATCATGGTGAGGAACACGATGTAGTGGAAGAACTCGTAGAAGTGAAGC
TGCTCCGAGGCCGTGAGATCGTTGAGTCTCAGCGATTTGAGCGCGCCGCTTGTGTTGAGCGTGAAGATGACCATGGACAGGAAGCCCAGGATCATGACCT
CCTCGAAGACGCGGTTCACGATCTTGCGGAGCTGCGGACACTTGATGGAGGCGCGGACGCACTCGATTAATCGGTCCACGGCGATAGAGATCGCAATGAT
CACTGCGAGCAGAAATACGGCCGTCTGGAGGTTCTCGTGTAGACACAGCGTGTTGCCGACGCCCAGGAACGACCCCGAGCTGTGGCAGTACGGGTTGCCT
TCCTCGTCACCCCCTGCGGCCAGCTCTCGCTGTAT