Description :
From Genome Similarity Track
Location :
Scaffold_89:4861- 9722
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_89-fgenesh-gene-0.10Kinesin
Pytve_DAOMBR484snap_masked-pve_contig_89-abinit-gene-0.70Protein claret segregational
Pytve_DAOMBR484maker-pve_contig_89-fgenesh-gene-0.12Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_89-fgenesh-gene-0.1Conserved gene of unknown function
Pytve_DAOMBR484fgenesh_masked-pve_contig_89-abinit-gene-0.96Novel protein

Sequence
4861 bases(100 bases per row)
ACGGAGTTCGAGGTTATGCTATTATGTAGTAGTGGTTTTGTCAGTTCGAGCGTGATGAAACTGCTATAGGAAACAGATTTCGCCGACCTTGATGCGCTTT
CAGTCCTCGGGATTTGATGCTGGCAGATGGAATCAGCGTATTCGTAAGCCCAACACCACAACACACGTTCATTTCCTCCTTTTGGCACACCTGACGAAGG
AACCAGTCGGTGCCGCTCGAGGTTTGGTACGAGATGGGACGACCTGTCTTCTTGAGGAAGCTGTGGCACAGCAAGCATAGATGAATCAATGCTAGGGGTA
AGATGTTTCTGACGACGAGATGCCTCACTCTCGCGCGAGGTCTCGAACGCGATCGCAGTAGATTTCGAGGAAGCTCACAACGAGTGTGACTTCCTGGAGG
TGCAAAGAGCCACCATCTGAGCAAGTAACTCGGCTTCAAATGCACAGGTGAGCCGTACCTTGGCTTTGGCCTCGTAGCGATCGACCATGTCGAACAGGTA
CTCAATTGATCGCGAGAGTAGCCCAGTCTTTTCACCGTGCTCCCCGAAGATGCTACCCACCAGGATCGTTAGCCACTTCGCGACAACAGATCCAGCGTGT
CTGAGAGTCGTGGCATAACATGACAATCCACCTGAACGTTTTGCCCGATCCGGTTTGCCCGTACGCAAAGCAGCAACTATTAATGCCTTTCAGCGCATAA
TCGACGAGGACCTTGCTCGACTGAATAATCAACCAAATTGAATCGTCATGCGTCGTGGCAGTGCTCACAGGCAAACGAAACGAGAACTGGTGCTAACCGA
CTCGAACAGCGTCGACTGAGACGTATCGGTCCAGTAAATCTGCTCCACCAGCCAGCCGAATATCAATGCGTTACCCTCCTCCTCTTGGTTGCCCTTACAA
AAACTCACATTGTCGAAGCTGAAGGCGTGGTTTCCGTACTGCATCCGCTCCGTGTCCTATTCGCCAAACTCTCGCGTGAGGAAAGACAGTCCATGTTCAC
GCCTCTGAGCGACAACATTCACCTTGATGACGATGTTCTTGGGCGTCTCCTTCTTGCGCTCAAACATGTCTTCGGATGGCGGCTGTCCGTCGGCGCATGG
TCGAGCTCGCACGAACACCTGATGAAAGTGAGCTCAGCTCCGCTCGGAGGGTCAAACATCTACCTGTTAAGAGCCACCTGCCTTGACATTGGCGTTGCCG
AGCGACCGCGTGTAGTCGGTGGTCACTTTGTGGTCCATGGCGGCGAGGACGTCGCCAACCGAGCTGGTGACGCTCGCGACGTTTGAACAGCCTTCTCTGT
CTCCTGTGATGTACTGTTGTCAACCGGAAATAGTGCTCGCTGCTTGACGAAACGGGTCACGGCTGAACGGCCAAGACCAACGGCACAAGATATGTTGTTG
CTGCTGTTGTTTGTCGAAATTGCTTACGCACACAATGATATTGATACACACGTACACTCGGCTCGTCCTCACATGCATCGAGCCACCTCACTCTCTCTCT
CACTTTCTCTCTCTTTCGCCCGCGCTGTCGGCGGCGAGTCGTACCCTCCCTCCTCTTCTGGTCTGTCCTGCAGGCCCTCGTCGATTCGGGGCCGGGTGAT
GGGAGCGCGAGCAGCACACAGTGCTGGCCGCTCGGTCGCTCCGGAGCTGGTTTAAATATTGGGTATGCCGAGGCTCTCGCCGACCGCTACAGCACGATCG
TCTCCTTGTTCTTGCGGTACGGACCGCTGTGGCGGCGGAAGTTGCCGTAGTGCGAGTGGGTCGACACGAGCAGGCTCTTGTTGAGATCGGACGTCCCCTT
GGCGTACGACAGGATCTGCGGCGAGTTGCGGTGCAGCCGCGGCTTGGAGCCCAGCGGCGTGTGCTGCTCCGGGCTCGGCGTGGCCGCCTTGACGTACGAC
GCGGCCTTGTTGAGTCCCTTGGCGATATTGGCGACTGCCGACGGTCGACGCGGCCGGGGGACCGACATGGTGCGCGCGCGGAAGAGCGAGTTGCCGATGG
CGGTCGAGAGCTTGCGCTGTCGTGGCGGCGGCGGCGGGATGCCCGGCCCTTCGTCGTCCTCGACGTTGTTGCTCGAGCCGTCCGAGCGGCCGCTGATGAC
CTCCACCATCGACTCGCACTGGTTGCGCAGCGACGAGAGCTCGTCGTCCACCTGCTGCAGCTCGTGCGAGAGCGCTCTTGCCTTGTCATGGCCGCGCGCC
ACGAGCAGGTCGCGCTCCGTGTTGAGCTGCATCATCTCGCGCTGCAGCGTCGTGTTGCGCGTGAGCAGCTCGTGGATCTCGCGCGCGATGCGCTCGTTCT
CGGCGCGCAGGTCCGAGGCGGCCGACGCCATGCTGGACCAACAACCTACCGAACGAGTGTCGTCGGATCTGCCTCTTTCGCCACTGAGCGTTCGAGGTTC
GGCCTTTTATCCGCTAGCCGGACCGATGGGTTTCAGGAACGACGCGCGGATAGTAAAGCTGACGGTTGTCGCTATTTCGAGCAAGTGCTTGCGACGTGCG
GATAGAAGATTCAGAGATTAGGCAACGGGCCAGCTGGCGGCAGGAGAGGGTATAGTGGGGCCAAGATGCCGGCGGAGAGTGCGACGTAGCGAACTCCGCC
TGGGCTGCACAGTCAATACAGCGGCCGCATAGAGAAGGCGGGCAATTTGCGGCGGTGGTGAGCCGGCCGTTGCAGAGAATGGGGACCGCAGGGATGTGCG
CGTCAAGAGAGAAGAGGGAGGAGAGAGCCACGGTCCGACGCCACGATTCGTCCACTTGCTCCGGGACTCGCGCGTTGCTCGATGCGAACCTGAAGGACGG
GCGATCTTGCCAGTTTCGGATCGCTCGACGCAGCCATACTGGCCGCAAGTGAGCGGTGCGGTTTCGCCACCGGACCTCAACGATATGGTGAGCACCGGCC
TGCTATTCGTGGCCAGCGTTTCAGAACGGCCCGGGTCGTGTGGCCGGGCTGCTTGAAGGCGCGCGATGCGTTGAAGGTAGCGGCGTGCTGCTGGGATCCT
TTGCCCGCGGAGAGGCGCGTGATCCCAGCCGCGAGCCAACTTCCGAGCCGAACTCTTCCGCTTCAACATGTGCTGAGCGTTCCTCGCTCTCTACCTGGAA
AAGCGGCGCAGTCGCCACGATATTTTTACCTTGACCTGTCATATTGGATATGTCATGTCAGAGTACCTGTAATATAGCCTTTCATCTGCACAGAATGCAG
TTCCAAAGGCTCGCCATCCTTCCAAACACCCCGAATCTGCCATGGACACCGAAGGCGACTCCCGCGTGCACTTCTCGGACGTGAGCGACCCGTGGGCGAG
CTCGCGCCATGTCGCGGTGTTGCAGTCGCTCGACGCGGTGGAACAGGTGCGTGCGGCTCGCGGTTGGCTTGACGCGCGCCTCGCTTTGGCCCCAGACTGA
CGGCGATCGCTTCTGGCTTGTCGTGGCGTCGCTCGGTCGCTCGCTGACTCGCAACACAGAAACTCGTGACGGCGCTGCGCACGGCCGCGGCCGCCATGAC
TCATCTGTCGCCGCGCGTGTCGTCGGACGAGAGCTCGGCCATCGCCTTCAACACGGCGTGCACCGAGTTCCTACAGCTCGTCAAGGACGTGCACGCCGAG
CTCGCGGGCCACATCCACCTCGTGTCCGACTACCGCGTGTTCGGCCGCTCCACGTACGGCGCCGACAAGGACGTCGACGTGACGCGCGAGAAGGTGCGCG
TCATCTCAGAGCAGCTCCAGGCGCTCTCGCGGTTCCTCGAGGAGCACTACGTCGCAGACGAGTCGCAATCTGCGGCACCTGCTGCCGTTGCTCAGTAAAC
CGATCAACCACGCGTCGTACCACTACTTTATCAAAGCCGTTCTACTGGGTGTATCGTGCTGGTGTTCGTGCGGTCAGTCGGCCCATGGACGGACGGACAG
GTCGGTGGCTCGGAACTGCTCAAAGTGCTGCTGCAGCTTGGCACGCAGGCGGCGCTCGTGTTTCAGCGTTGCGGCGTCGTCGCCATTGTCGCCACCGTCG
CCTTCGTCACCGTCCTCGCCAGTGTTGGAATGGTTTTGCAGCTGCAACTGCGCGGGAATAACGCAGGTGTCAGACGCGGTTCATGCTGAGACACAGTGCC
GGACGCGAGCGAACCTCCTCGACGTAGTCGCGGGCGGCGACTTCTAGGTTATACTTGATGTCTTGAAGCACGCGGTCGTCGCCCTCATTGAGCTGAGGCG
ACGGCTGGAACGGCTTGAACCATCCGTCGCGATAGAACTGCAGCCGTAGGAACCGCTGGTGCTCCGAGTCTTGCAGCAGAAGATCCGCGAACGCGCTGCT
GTCGCCGCCGTCGTTGGCGCTGCCCGTCCATCGCGCAACTGAGCTCAGTGGAGCCACAAACAACCCGGCAAGTTGCGGTGCTGCCATCTACAGAAGGGTC
AGCGCAACACAGCGAGGGAAACCAACCTGCACTCGAAGTCACCTGAGACACAGCGACGACGATTTGGTACAGGGTGGCGGCAGCTGTGGTCCATTTGAGA
GAACGGGATCGCTCCACAACGAGTGCGAACGCTAGCGGGACGAGTACGCCGCACTCCTTCACCTTGAAAAGCAACACAACCGTGCAGAGTCAGCACGCAA
TGTTGAAATCGTTGAAGGCTCGAACAGTGGATCACCAGGATGGAGACGATAGGTGCGTTGGACAGCAGCAGTGCACTCACGGCACTCGCAGTGCGCACGA
ACAGCGACCGCAGGTGGGTAAACACTTCGTACTCTTTTGTGTCGGCTACGGCGAGAAAGCAGTCGTCTAGTCTAAGGCAGTTTAGTGTCTCGGCAACGGC
AATGATAAAGAGGGATGAATGGCTTACCGGTCGTGATTCTTGGCCGCATCGCTCAACACCG