Description :
From Genome Similarity Track
Location :
contig_39:486051- 487469
Transcript NameFunction/comments
g8252.t1RAW24683.1 hypothetical protein PC110_g18888 [Phytophthora cactorum

Sequence
1418 bases(100 bases per row)
AACCAAAATGGGTCCTGTACACGAGCGTGCTACTTGGAGTCATGATTTCGATGCAGTACGGATGGTCGACGTCCCAGCTCAACTACTCCAAGTTCAACAA
GGAGAAAGACTGCAACGCTCGCCCCGTCGCCAATGGCACGTGCACCATGTTCCCTGGACACTCTAAGGCGGAGTGGACGGTCGTTGTCAATGCCTGGGTG
TTTGGTGGAATGATCGGGGCTCTCTTGGTCGGCAAGATTTCGGATCAAGTAGGACGCAAGCGAGCGCTGATGTACAACTGCGGCTTCATCATCGCTGGCG
CTACGATCCAGGCAGCGGTGTCCAACATTTGGGCGTTCGCGTTCGGTCGTCTCTTAGCTGGGATTGCGTCGGGAGCTAGCACCGGATGCGTGGGGACCTA
CATCAACGAGATTGCGCCTCCTCACCTTCGCTCGAAGCTCGGCATCGGCCTTCAGGGTGGAATCAACCTCGGCATCGTGCTGGTCGACACCACGCACTTC
TACCTGGGCTTTGACCAAGGCTGGCGGATTATCGCCGGCTTCCCCATCGTGTTAGGAACGCTGTTTTGGCTCTGTCCCATTTCGTCATGGTCGAGTCTCC
AGTGTGGCTGCTGCTCCACGGACACCGCAAGGAGGGCGAGCAGGTGCTCGTTCGGCTCTACGGTGAAGAGAACGTCAACACCGCACTGTCCTGGATCAAG
CCGGAGAAGAAAGCGGTGGATGTGGAGAAGCAGACCCCGTGCTGGAGTGAGGTTGGTCACGAGACTGTGATCAAGGGCAAAGGTCTCACCTGGGGCGAGC
TGTTTGCAGTCGAGATGCGCAGACCGCTGGTGGTCGGCATGGGGCTCGCGTGCATGCAGAAGCTCACGGGTATCAACTCCATCTTCTACTACTCGTCCAG
CCTGTTCGGCGGCGTTGGTGTCGCGGACGGCCGTGTCTGCAACATCATCGTGGCTATCGTCAACCTCATCCCGACGCTGTGCTCGGGTATGATCTCGGCC
AAGTTCGGCAACCGCCCGATGATCCTCTTCAGTACGGTCGGCATGTGCGTCAGTGCCGTCGGGATCACGCTGTCCCTCGCGTTCGACGCTCCGCAAGCGA
CGGTCGCTCTTGCTGCTGCCTTCGTCTTCTCGTTCGCTATCTGCCTCGGCCCAATCATGTTCGTGGTCGTCGCTGCCGTCGTCCCGGATCACGCTCGCGG
CTCGGTCGTGTCCATTGGCATTTTCGTTGCCTGGGCCGCCAACCTGCTCGTCGGCATCGGCTACCCTTACATGGCCACGGCGCTGGACACGTACAAGTAT
GTCCCGTTCGCGGTCATCTCCGCACTCTCGACCGTCTTCGTGTACTACCTGGTCCCGGAGACGTCGAACTTGACGACTGCCGAGATCCAGGACGTGTTCA
AGAAGATCCGCGGCAATG