Description :
From Genome Similarity Track
Location :
scaffold_1681:486- 3112
Transcript NameFunction/comments
Pl_100425hypothetical protein PHYSODRAFT_249285

Sequence
2626 bases(100 bases per row)
GGCTTCGCGGCACTCACAAGCCCATGTGCGACGGACGGACCACTGGTTTCCACGTCAACCGCTCTAGACATGCCTCGAAAAGCAAGCTCTAGTGGAGCTA
CTGATCTTCCCAAGTCGAAGACAGGAAGTTGACCAACCTGCGCGGCAAGATCACTCCTCATCAAGAAGCCCATGGAGGGGAACTTCAGAAGCAGCCGGCT
CCGCTGCTACTGCTGCCGCTAAGGGTGCAAGCCCGTGACGCAGTCGCTCTTACTTTCACTCATCGGGTGGCCAGCAAAGCCCCGGTTCGCGTACCGTGTG
CAAGTCCGGGTTCCGGGAGCTCAGGGTCGAGCAGCTCCGAACTTCACATTCCTGTGATCACGGGGTCTGACTCTGGTTGTGAAGCCCAGGAGTCTGTGGA
AGCTCCTGCGGTTAGTGTCCGATAAATACAAAAGGGGTTGTGATGACCCTAAGACCAGCCCAAAGTCGGCTGAAGCGGATCTAGCCACTGCTAACTCGCC
TTGACGGTACTTTACCCTGGCGGAGAGCCAAGCTCGGGCGAAGACCGTCAAGGCCGCTGCGGCCTCTAAGGTGGTCGAGAAAGTTGCTGCACCTAAGAAG
CGCGCAGCATCAAGTTCTTCTTGTCGAGATTTGACAGAGAATAAAGGATATCGGGGATTATTTGATGGAAGTTCTGATTCCGACGAGGAGGGGATTGTAC
ACGTATTCCGGGAAACAACTAACGATCTTGATGAGCAACAGAAATGGTATCGTGCTACTCAGGCGCAAACCCCTGCTGAGATTGCGCTAGTACTCCTTCG
TACCCTAGAGGTTATTATCCACCAGACGCGGTGTCGGGCTCTCCGATGTTTCTAGAGAGACTTCAGAGTCCTCGTGGCCTCACCCACAGGCGCACGTCTC
GTGGAGTCTATGAACAATCCTTCGTTCAGCAATCCCTCGTTCAGAATTATCCGCTCTTCATTGAAGATACTAAGGGGGCTAGGCGCACGCTGTTGACAGC
GCACCGAATTTCTCTGAAAGATTTCATCAGCCTCCGCAAGAAACCGTAGAATCGTGGTCGGTGTGGGGTTACCCTTGGGTACAGACTGAGAAGACTTCAA
CTCCGGCACATATTAAGAACCTGCTCTGGAACTGGGTTACTCTGCAGATTTATTCAGCTCAGGAGTTAATTGAACTCCATGAACATCGCATGCTGTCCCA
CATATTGGATCAGCGCAATCTTCGCATTAAGTTTTCTCATCTCATCGGTAAGTGCCAACTCCATTCCGCTATGTATACACCAGACTCAAGCAACTAGCTC
GGTCTGGCGCTCATGAACGCGGGTACGACTTATATTCTAGTGCCGCACCCCGGAAATTGGCTAAGAAGCTGAGGAGTACTTACAAGCTGCTGTTGCTTTT
GGTCCCAGATCGCAACAGCCTTCAGACAGCCGGTCCTCCGGTTCCCATGAGTTTTGTGAAGACGGATAACCCCGCCACTTCACAAACAGCTGGTGCTTCC
TGAGCGCCGGCGCTCCTGGACAACCCGCTCCATGTGGAAGTGGGGTTCACCGTTCCAGTCCAGGAAGGCAGGTGGAGCCTCGCGCGTTTGAGTACGAGGC
TCCCCGCACTGAGTCTCCGAGACCCTCTGCTTCGGGTTGGGGCTCTGCCGATTCCTTTCCGCAGGAGGAATTCTGGCGACTTCGAGATCGCATACACGAG
ATTGAGATTGCTCTGGGCATTGGCCCTGGTTGTCAAGCCGCTGCCCAATCGGGAAAGTTGGGTGCCCTCGACTCCCTTCGCCACAATGTGCACGGTTTGG
GTCGCGAGACCTGGGAGCTTCATGGCTGTGTTGACCGTGGGGCTCTGGCTTCCACCTCCGCCGAGACCTCGGCTATTTGGTCCGGAGGTCCGTAGCCGGG
CATCTTCTCGGGAGCCCCAAGGGTATTCGTATCACCCGACTTATACATATGGCTCCTATGGAGGACCATCCTGCCTTTCCTGTACAGGCTATGACCACCT
AAGTGAGGGTTGTCCTTGGAGCTCCACATCGGTTTGAAGAGGTGAGATTGACCCCTCTCGGGCCTCTGCCTCCTGCCGAGGAGAGGGTCCAGCGGACCGT
GATACCGCTTAAGACGGCCCACGTAGAACGTTGGGCGGGTCGTCGTAGACTTTGGTAAGTCTATCGTGTAGGCGGTCTCATGTCTGCCAAGGACCGCAAA
GGCCCAATGAGTTCTACTCAATAATGGAGTAGGCCATCGACCAGCTCATATCGGTGAAGCTGCGTCCGCTGTCGAGGCGAGAGCCTATCGACCTTCGCAT
CCTTGCCTTTAAACAAGAACCACACCAGAAGTGTGAAGTTCTCATCTTCCCGATACACCAAGCATATCCGATCGTACAGATCAGTCGTGGCCCGACTTAT
GCGCGCTAACTCAGTCGTGTCGACGCGACAAAGCGTCGGCAAACACGTTGAGCTTACCCGGCTTGTATTCAACGCGGAAGTTGTATTCTGCGAAGAATGA
CGACTACCTCACCATCCGCTGCAATATGTGCGGCAAATTCGTGGCAGTCCACAAGGACGCGTAATCAGTGTAGATCACAAAGGGCGTCGATCCCAATAGG
CGTGCTATAAATTTGACAAGAGCGTA