Description :
From Genome Similarity Track
Location :
scaffold_608:486- 2032
Transcript NameFunction/comments
Pl_103475hypothetical protein PHYSODRAFT_254033
Pl_103476NA

Sequence
1546 bases(100 bases per row)
CATTTTGACCGACGTGAAAGTAGAAACGATATCAGCGAAATTCAGACTCTTCTCAGGAGGAAGTCTCTCGTATATGAGCTGCACGAATTCGCAATATCCA
CTGAAATATGCTACCTCAAGTGGTGGCCAGTTCTGGAAATCTCCAGACAAGTTGAGATCCGCTCCACTATCCATGAGAATCCGAACGACATCCAGTTGTT
TATACCAAATTGCTGTGACCAAAGCCGTCCCACCACTGGGTAACCTCGCATCCACTTTGGCACCTCGATTTACGAGAAATTGTACTATATCGGAATATCC
CAGCTGTGCTGCTGTGATCAACGGCGTATAGCCTTCATTGTCCGCTAGTTCGATGGAAGCTCCATGATTCACAAGGACCACGACAATATCCATTTGGCCA
TATTCGCACGCAATATTCAGCGCCGTGGCCCCAGTAGGTAGTTGTAAATTGACCGCTTGATCGGCCGTCTTAGATTTCAACAATGCCTTCACCACACTCA
CGTACCCTTGTTCAGTCGCCTTCAGCAGAGCTGTCCAACCTGCGTTATTAGTTAAACAAATGGATACATCACTCGCAAGCAACAAATCCACAATCTCGGT
GTGTCCTTGTCTTGCGGCCGTGAACAGCGGGCTGTCGCCATCATTATCTACCGTGTTACTCGACGCACCATAGTCGAGAAGCAGTTTTACAGCCCCGACA
TTACCATTTTCACAGGCAATCTGAAGACTGTTAAATCCATTCGGAAGCCGTTTATCGATTACTGCTCCGTTCTCCAGTAGAAGCGCTATAACATTGTCAT
GCCCTTTCTCCGAAGCGTGCATCATTGCCGTCCAACCAAAGTCATCACACATATCGATGGACGCATCATTTTCGACAAGAAATCTCACAATGTCGTCGAA
ACCATTGCTGGCTGCAATACCCAATGCAGAATTCCCTTCCACGTTTGTCATGTCGGTCTCAGCTCCTCTCTCAAGAAGAAGCCGAGCAACATCGATGCTT
CCGTTTTCACACGCGATCATAAGTGCCGTCATTCCGCGCAATCCTTGTTTGTTGATTCTTGCTCCTTTATCCAGCAATGTTGCCACCACATCAACGAAAT
TTTTCTCCGAGGCACTCGTCAGCGCAGTCCAGCCGGTGTAGTTTATCAAGTCAACCGAAGCACCACATTCTAATAGCAACGTGACCACATCTGGGTACCC
ATTTTCGGAAGGGGAGAATCGCCATCGATGTCAAGTGCATTGACGCATGCATCCTTATTACACAGTAATTGAGCTACATCACGGTGGCCACTCTCACCCG
CTAGGTGGAGACCAGTGTATCCACTTGAAAGTTCTGCATCAATTGACGCGCCATTCCCCAATAACAGTGTGACCACGTCGCTATGACCGTTAGAAGATGC
CCATAGCAATGCATTCCAACCATTATTGTTTGCCACGTCGATACTTGCACGGTTGTTTACTAGAAGCTCCACAATCTCGAAATGTCCATTCTCCGCTGCA
CAGATCAACGGGTATTTCCATCTTTATCCTCCACATTGATCTCCGT