Description :
From Genome Similarity Track
Location :
Scaffold_1864:4859- 6582
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1864-fgenesh-gene-0.1CTP synthase

Sequence
1723 bases(100 bases per row)
CACCATGAAGTACCTCGCAGTCACGGGCGGCACCGTGAGCGGCCTCGGCAAGGGCATCACCATCAGCAGCATTGGCGTCGTGCTCAAGGCCTGCGGCCTG
CGCGTCACGTCCATCAAGATCGACCCGTACCTCAACTGCGACGCCGGCACCATGTCCCCCTTTGAGCACGGCGAGGTCTTCGTGCTCGATGACGGCGGCG
AAGGCGACCTCGACCTGGGCAACTACGAGCGCTTTCTCGGCGTCACGCTCACACGCGACCACAACATCACGACGGGCAAGGTGTACCAGCAGGTGCTCGA
GAAGGAGCGCCGCGGGGACTACCTGGGCAAGACCGTGCAGGTCGTGCCCCACGTCTCGGACGCGATCCAGGACTGGATCGAGCGCGTGGCGCAGCTGCCC
GTGGACGGCAGTTCCGACGTTGCTGACGTCTGCCTCATCGAAGTCGGCGGCACGGTCGGCGACATTGAGAGCATGATCTTTCTCGAGGCTCTGCGCCAGT
TCCAGTTCCGCGTCGGCGTCGAGAACTTCTGTCTCGTCCACGTCTCGCTCGTGCCCGTGCTTGGCTCGGTCGGCGAGCAAAAGACCAAGCCTACGCAGCA
CGCGATCAAGGAGCTGCGCAGTGCCGGGCTGTCGCCCGATGTCATTATCTGCCGCGCGAGCTCGCAGCTCGAGCCGTCCACCAAGTCCAAGATTGGCATG
TTTTGCCAGGTCTCGGCCAACCACGTGCTGTCGGTCCACGACGTGAGCAACATTTACCACGTGCCGTTGCTGCTCTCGAAGCAGGGTGCCGCCAGCATTC
TGCTCTCGCGCCTGCAGCTCATGAGCCGCTTCCGCGAACCTGAGCTCGCCGAATGGGCAGCTATGGCCCACCGCGTGGATGGCTACACTGAGACCTGTCG
CATCGCGCTCGTGGGCAAGTACACGGGACTCCAGGACTCGTACCTGAGTGTGATCAAGGCACTCAAGCACGCGACCATGAAGTGCGACCGCGATCTCGTG
ATTGAGTGGATCGAGGCCTCGGACCTCGAAGATGACATGAAGCGCACGGACGCCGACCGCCACAGTGCGGCCTGGACCAAACTGCGTGCGTGCAACGGCA
TTGTTGTGCCCGGTGGCTTTGGCGACCGTGGCGTCGATGGCAAGGTGCTTACGGCACAGTACGCGCGCGAAAACAAAGTGCCGTACCTGGGCATTTGCCT
TGGCATGCAGGTCGCTGTGATTGAGTATGCCCGCAATGTCGTGGGCTGGAAAGACGCCACGAGCGAAGAGTTTGACGCGAACTCGGCCCACAAGGTCGTG
GTGTTCATGCCTGAGATCAACCCCGAGGTCATGGGTGGCACGATGCGCTGCGGAGCGCGCGAGACGGTGCTCCACGAGAAGAACAGCGAGGACCCGACCA
AGCGCTCGCTGGCGTCGTACCTCTACGGCAAGGGCCAGCGGATCATGGAGCGCCACCGCCACCGGTACGAAGTGAACCCGGACGTGGTCGAGACGATCAA
GAATGCCGGGCTCAACTTTGTGGGCACGGACACCAAGAGCGTGCGCATGCAGATCGTCGAGCTCGACCGCGACGTGCATCCGTTCTACTTTGCGTCGCAG
TACCACCCCGAGTTCAAGTCGCGTCCGGTGGAGCCGTCGCCGCCGTTCTACGGATTGATTCTCGCGGCCACGGGCAAGCTCCAGGCGTTCATGGACGAGT
GCGAGGCCAAGGGCAAGTGAGCG