Description :
From Genome Similarity Track
Location :
Scaffold_79:48577- 52177
Transcript NameFunction/comments
Physo_139826reverse transcriptase

Sequence
3600 bases(100 bases per row)
GGACACTCTCAGTGCGAAGACAAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAGACGAGTCCCTACTACGAGATCTTACGGGAGTACGCG
GACGTACTTCCGGAAGAGATCCCTGCGGAGTTTCCGCAGGATAAGGGCATCCAGCACGAGATTGATCTCGTACCGGGGACGAAGTACTGTGTCACGCGGC
AGTGGCCACTGCCGCGAGAGCAGGACAAGGCAATCGGCGAGTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAGTCCCCGCACAGTGC
TCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGGCGCAGACGCCGATACCT
CGACAAGATGTCATTATCGATTCGATGGCCAGGAGCACTATCTACAATGCTCATGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATA
TCCCTCTCACGGCTGTGAGCACGCCGAGCGGCATACTCTGGGAGTGGCTAGTGATGCCGCAGGGTCTGAAGAACGCCCCTGCGACCTTCAACAGGTGCGT
GACGCACTTGTTGCGCTTGGTGCGCGACTTCGCACCGTGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACAGGATGAGTGATGTTGAGATG
TACAAGGTGCATCTCCGGAAGCAGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGC
TCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGGAGGTCAGAGTGATCAATGAGTGGCTGACGCCGTCGAACGTCAAGGAACTGCGGCA
GTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGGAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGACGAAGGACGCCGAGTGGGTT
TGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCGATCTTGGCGGATGCCGACCAAGATCGCCCATTCCACGTTG
TGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCTGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGTC
AGCTGAACGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTG
GTCTATACGGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCC
GGGTTGAGTACAAACCCGCAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGC
CATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGCCGTGAAGGTCGCACACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCG
CCTTCTGACAAAGCCCGTCAGAAGCTACCGAAGCATATTCGTGCTCGTGCACACCGTTATCGGGTGCTCGATGGGTTATTACTCTACAGTGCAGTCGACG
ACAACGCGGAACGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTATGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGA
GAAGACACACCTTCTTCTCACACGAGACTTCTACTCGGCCCACCAGTATAAATGGGTACGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAATGTGTGAAG
CCTGCGCCTTTCGTGAGGCTCCCTTGCAGTCACTACCGACTCCACGGGAGTGTTGGCAGTCCTTGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAG
CCAGGGGAACACGGGCATTGTGGTCTTTGTTGACCGCTTCAGTAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGT
CTATTCGTTGACGTGGTGTTTGAACACCATGGCATGCCAATCGACATTGTGTCGAATCGGGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTA
CACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCGTAGACGTGCTTAAGAG
CTACGCTCACTCGTTCCAACACTGGAGCGAGTGTCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACTGGGCATACACCGTTCTAC
GTGAATGCCATGAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGATCTCCGACTGCAACGCAGCAGCTACGGAATG
CCGCTGACACTTGCACAGTGTCAGCCGCAACGACACGAAGCAAAGCCGAGAACCGCGCGTCTGTGCAGGGCACAGACGCCGACAAGCGCACGAACAACGT
GTCCGTGCGGGGCACAGACACTGACAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAACGGGTCTGTGCAGGGCACAGACACC
GCGAAGACGAACGCAGAGGCCGGGCCTACTGCTGGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTC
GGTTTGTCCAAGACGCGATTGCAGCTTCTGTTGATCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGCAACACAAATGAATTCGAGAAGGGTTCATT
GGTTTTGTTGGCTACTCAAAACCTGCCTAAACATGCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGGTCACTGTGCTGGCA
CGGCACGGCAACGCCTACACGCTAGATATTCCATCTTGCATGCGCCTCCATCCGACCTTTTACGTCGGGCAGCTGAAGCCATACCGGCAGCACGAGCCAC
CTGGCTCGGCTGAACCACAGAAGACTCGGCGGAAGCCGTCATCCTCTCCAGCGCGAAGTCGCGCTGGAGCAGCGGGTCGAGCTAATGGTCCAGCTCGGCC
GGAACGATCGAGGCGGCCTGGGAGGCCGCCGCAACCTGAGGAAACTTCAGAGCGCCGAACCCAGCGCTCTAGAACTACTCCACGACCGGGACTTGGTCGT
GGGGAGACGCGAGATCAGGGTCAACACCAAGTTGACCACACACGGGGCGTGTTTCCACCACCACCACCGCCAATTCGTGACGCACACGGCTCAACTCGAT
GGATAGTTGAGCGGATTGTTGGTCACAGTATCCCGAGAACGAACAGGCAACCGGTTCGTTTTCGTATCCGTTGGAGAGGATTCCCTCCCAGCCAAGATAC
ATGGGAGCCGCGGAACGTCTTGCTCGAAGACGTCCCGAACTTGGTGAGGGCGCACGAAGCCCACCATGCGCTACACGCTGGAAAGTAATACGAGCGCTGT