Description :
From Genome Similarity Track
Location :
contig_8:485670- 487212
Transcript NameFunction/comments
g1639.t1hypothetical protein PHYSODRAFT_492736

Sequence
1542 bases(100 bases per row)
TCCACAACAAACTCACTCTATCTATCTAACTCACATTGAGCTGGGCTTCCACCTCCAAGTGGCCTCCTTGAGGCGCAATAGGCACCCACATCACAAGCGA
TCCACCGCCAGTGCCAGGAAGGCCCAGGAAACCCGGACGCCAACGGTCGAGGTACAACGTCTTGCCACCCAGTGCCGTGATATTGGACGTCCACTGGGCA
GTGGCGCCCGCAGCGACATCAATTTCGTCGATTTTGTCACCGCCAGACATGATGTTCACAGTCACGTCCTCTGTATCCTTGCTGGTGAAGTTGATGATCA
CCGCACCGTCTCCCTTCTTCGTCCACGAGATCGTCGTGTTCTTGAAAGCTTTCTTGAGCGCATTCATGCCGAGGGTGGCTGCCTCATTGCCATCGTCGAT
CTCTCCCATAAAGCGAGTGGGGCCACAAATGGTCTGCAAATACTCAGAAAGCAACGTCGACAGATCCGTCGGGTCCAGGCCCGTCACTGAGAGAGTGGTG
AGGCCATTATCGATCCACAAGTAAGCAGCTTGCTTGTCATCAATGGACGTGCCGTTGTCACTCTTGCCAGACTTAATGAGGTCGTCGATAATGACTCCGA
AGGTCTTGCGGAGCGTCTCGCGCGTCTTGTACGCGGTGGCCTGCGTGGACTGCGAGATCATCTGGCTCATGCAGTTGTTGGTCACCGTTGCGATGTCGTA
CATCACAAGGTCGGACTCGCTGACTTTGAGGCGGACTTCGGCATCGGAGATAGCGGGGTTCTCCTCCCGGTACTCGTTCACAGTCATCCAGACGCGGTTC
GTCAAGGACCGCATGTCATCGCCGCACGTCGAGTTCTGCTTCATGGCCGTCTCGAGATCCGAAATTTCTCCATCGGTGATCTCGCTGGCAGCCTCGGTGA
AGTTGGCTCCCTCCATGAAGGCCTTGAACTTGTCCCAGCTCGACACGATGCTATCGTCGTAGGCGAGAATATTCAGAAGGATCCACTGAGCGGTGGCCAT
CAGACCCTGCGAGAGGCGAAGACCAGAAGGCACAGCCTTGCCCAAACACGCGTAGATGGCAATAGGCAGATCCGTGACGACGTTGTTCGTCTGGTACAGC
AGCAGCAGAAGCTTGTCCGTCGACGTTTCCGGGTTACTCGTCGCTTGGTTACGCATGAAACGGATGATAGCTCTCGTCACCGTCAGCAGCGAGTTGGTGC
ACTTGACTGCCCAAGTCACCTTCTTTCCCAGTTTGGCGAGCTCGCCGAACACACCAAAAGTAGCCATACTCAAGGTGGACATGGCAAGCGCAGAGACCTT
GGCGGCGACTTGACGTCCGCAGTCATTGTTCTGCTGGATGCATTCCATGTTGCACTCGACCGGGTAGTCCATCGGACACTCCGTCCAACAGTGTTGGTCG
CCTCGTTGCGGTCGTAGTTGCTAGGGCAAGTGTCCATGATGTGAGCTTCTCGGTAGCAGGCGGAGTCGGCCGATTGGCTCCAGGGCCCCACCCAGTTGCG
GTACGTAGAAGTGATTGTGCTGGTGGCGCCGGCGTGCGTCGC