Description :
From Genome Similarity Track
Location :
Scaffold_90:48560- 57011
Transcript NameFunction/comments
Hyaar_Emoy2808872hypothetical protein
Hyaar_Emoy2808873dihydrodipicolinate synthase, putative
Hyaar_Emoy2808875predicted protein
Hyaar_Emoy2808874predicted protein

Sequence
8451 bases(100 bases per row)
TTCTAAGAAGGGATTGCAGTCGGACCTACACGGACATCAAGAGACCGATTCTGGTACGAAGAAGACGACCGAGTCCCCGAATTCTGGTGGTCCGAACGAA
GGCGCCAACCAGACGGGCGACAAGGAGACAGAACCGTCGGGACTGACCGAGTCAGCTTCGACGTCCAAAGGCGGTGGCGTCTTTGGTAAAAGCGGCATTG
CGATTATTGGTGTGATCGTGGGTATCTGTATTGCGGTTCTCGCCGGGTTCATCTTCATGATCCGTCGCCGCAAGCAACAGCGTGCAAATGCGAACAAGGC
GTTTGACCTGGACTCGCCCTGTGTGGTGAGTGAAATGAATGACAGCGTTCCCAATAGCAAGACTGGTGGTAATATCGACCTGACGTATGTCGCAAACGTC
TCGGCCCGCAATACTGACAGCAAGGCAAATGACAACATGATGAGCGACAACGTGGCTGCATTCGAGAATGGATCGAAGGCCAGCTCGATTGCCGATGGTT
CTATGCATTCGCTCCCTAAGAGCAGCTTGGACACTGATAAGTACTCGGAAGACATTCGCTATGGTATTGCGGGATCTGCAGGACACCCGAACGAGGCTGA
AATCGATGCTTACCGCATGAGTAACACATCAGGAGTTTCCTCGTACGTCAGCGTCGCCCGGAGCGACGCGTCTATGTCTCACTTTGGTGACTCACTGGTA
TCGGCGAGTCAGAAAAAGTATCTGCAGCCTGGTGATTGGAATGACTCGATGTCGTCCCAAATGGACTCCCGCTTGCAATCGACGGAGCAAGCTGAAACAA
TGACTCGCGGAGTTGGTGGTATCGGTGGTTCTAGCATGACGAGCATGTCATCAGTCGACAACGCTTCAAGCGCCACGGGATCAAGAGAGCACGATTCGAT
GGTAGGATCGCACTTCAATGACGAGCTACGCTCGACCACTGGTTATCGTGAAACGGAAGACTCGCGTGCAAGTGAGGATTCTCGCGCCACGGGCTTTTTA
GAAGCAATGGGCGAATCTCGACTACAGAGCGAGGTGTCAGTCGACTCATACGGTTTCCGAGCATCGTGTTCGAGCACAGACTCGTACAGCTCCGGTATGT
CTTCCTACAGTCGAGGGAGCTCTCGCATCAGCGGCTGTAGCGTCGATTCGAACCTGGACAGCTCCAACAGCTTTAGCAAGTACTAGGCCAGTGTTTCAAT
GTGTTTTGACCTGCCTGGAAACGAGGCAGGGTTAGTTATGACGGGTTCCCATGTGAGTGAGTGAAGGATGTGATTTGTTCTTGCGTCTGTCGTCCGGTCA
TCGCCTTGTAGTCAATACCAATGTATCATGAGTCGATGGCCAAAACACAACTGCTTTTCGCTGATGACCACACGTCCGAGCAACCATCAACAACACCATT
TTGCATGTTCCAGTAGTATTGCGACCAGTTGAATACAAAGTAGCATGTTACCGCACTCGTGGGTATACTGGAACCGCAGTCTCTTTGCAGCTGCTTTAGA
TAAGCTTGTGCTCCTTGGCTAATTTCGTGAGGTTCTCAATAGTCGATGGTTCGCACTCGACCAGAGGAGCGCGTACGGCAGGCGAACACTTGCCCATGAG
CTGCAGCACCTTTTTGATGGGCTGCGGGTTAGCTTCACTGAAAAGCGATTTGACAAGAAAGATCTGTTCGTAAACAGCAACGCGAGCACGAAACAAATAG
CATCCTGAGTCAGCACTGCTTACTAAGATAAAGATTCACATTGCTGCTTCCACGTACGTTCTCGAAAGCAGCTTTGCGAGCAGTGGCGTAGTCCCCCTTA
AGCATCGGCTCCGTGACGGCCAGCACCTTTTTGGGAGCTGCTCAAATACGTTTCCAGACATAGCGTGAGTTTCATGCTTCTATCTCAACAACAAGTCATC
TTGAGCGCTATAACTCACATGCGTTCGAAAGCACACTGATGACACCCGTGGCACCCATTGCCATGAGTGGCAGCGTCAGGTTATCGTCGCCGGATAAGAT
CGTGATGTCGCAAAGGGCAGCAATTTCCATGGCCTGGTCCAGCGAGCCTGTAGATTCCTTGATGGCTACAATGTTGGGCAGCTTGTAGAGCTCTGCTATG
GTCTCAGGCGACAGGTTGACATTCGTCCGACCCGGAATGTTGTACACGACCACGGGTAGACCCACCTCAGCCACAGCCTTAAAGTGGGCGTACAAGCCCT
TCTGCGTCGGCTTGTTGTAGTATGGACACACCACTAGACAGGCATCAGCTCCATGCTCTTTTGCTGCACGCGTGAGTCGCAGCGCCTCCACCGTGCTGTT
GGAACCTGTGCCAGCAATCACAGGGACGCGTCCGTTGACTGTAGCGACTACTTCTGCGATCACGCGGTCGTGCTCCTCATGCGAGACCGTGGGGCACTCG
CCTGTCGTACCCATCTGTTGCAGTACATTGTCGTTAGTATCTAATAAGGAGCTAAAGGAACAACTAAGAAATTATTTATGATACTGCAATGACGTACAGG
TACAAGCCCATTGATACCCTCCTGGATCTGCCACTCTACTAGCTCCCGCAGCTTGACGTAGTCCACGGCACCACCATCCTCCGTGAAAGGCGTTACGAGC
GCCGTAAATGTTCCTTGCAGCTTCAGCGTCATGATTCTAGTGGTCACGAGGTAGTGATTAGTTTATTGAAATGGGTGGCTGCGCGATGGGTACAGAGATA
GATGGATACACAACATTGGTGAAAGAGTGGATCGAGCACTATGAAGAGGTACTTTACCGGATACGAGTGGTACCTTCGATGCTCTGCTATGCTGTATCGT
TGCTTGATTATCCGGAGACGTTGCGTCGCTTGGGTTCAGTCAAATTAGCTCTACTGATCGCTGAAACTCAACATCGTGATTACGTACGGGTTATTACTTG
CCATGGACGATGACAATAACTTTACTGATAGACTTGCTAGATGTAAATCCAGAAGAGTCCGGGCGGACCTCGACAAGTGCGAGCACCCCTTCAATTGAAC
GACAGAGCGGTTATTACAGGACTACGTTACCACTGTAACTTGTCGCAGGAAACTTGCTCGCAAAAGTCTATTGCTCGATTGGATATCGGGCTGCTCGTGA
TAGTAAGATTGCTGTATTCAGCTCGTACAGCGCTCTTGACATAGTAGCATCCGTTCGTTGTGTTGTTTGTCGGGCCCTGGCTCACTTTTATCTCGAGTAC
GAGTGTCGCCACTCTTCTGTAGTACGACTACTTCACGGCACAAATTCGAGTATCCACCTGATTGCATAGACTGTTTATGATACAGTATACACCTACAAGC
GGTCGCGAAAGACCCTGCACGACTCATCGCATGCCATACTGAAGGTATGCACTCCTAAGTGTTTCAAAAACATGCGGCAAGCACGTAAGACCGATGCTAG
TGTCAAGTCAGTATGCTTGTCTGTAGCCATGAGGAATGATATATGACGAGAGGCTGCTTCGTGAACAACGCGAGGTCAAAATCATCTACGAACTTACCAC
ATCCGTTTCGACGCGCCGTTAGTGTCACTGTGTCCCCACTGATGCAATCTTGCCCTTGAACCACCCGCCGTGTATATGACCTCGTTCGTCAGCAAGCCAC
TGTTAACACACTTGTTTCTGCGTCCTTTCGTTCTCATGCTGAATCGCTTTTTTCGAGACAGAGTTCTTGTTTACTACGTGTCTGAACTCAACATAATTCT
TCCAACGTGATCTCTCGCTTCGCTGTTCGTAATGGCCTTACTTTCTACCAGTTTGCAAGGCATCGGTTCGGACAACCACGCTCATTTGTTGTCGCAACCA
GCGAGTTGCTGCCACTCTTTTGTTAGCCGATGCTTCACCAGTGGCGATTTGGTTTGTGTCTCACATACAAGCGTAGCTTTGACGCTCGACAAAGAGAACT
ATTCGTGTTTAAGTTTGCTTGCTTGTGGAGTGTGATCCGATTGAAATCTCTCGCTTTACTCGACGATGAACTCAGCAACAATATATTCTGCGTGATACAC
GCACTTGCGTGGAGGTGGCATGCGCAAAGCATCACCATAACTTTCAACTGCTTGTTGTGCTGTTCTCGCGGAGGTGCGCAAGCAACAATCCTTTCACCTT
GTCGATTCCCTTCGGCAACGAACTGTGTCATCATCGTTCTCATTAACTGATCGAGGTATAAGGTGCGCACGCTGGACAATCTCCACGAGAACAGCTACGG
TGCATGACAGCAGCGAAATTCGAGGGATTGCAACTGGTGGCAGGTGACACAGCCCAATTTGCAGGGCCCAGAGATCCCACACAGGCTTGCAGCTACACCA
AAATGGTATGTTTCTCTTACATCCTTAACAAACGTCGACCATCACGACTTGTGTGACTCCATACTGTCTACACTCGGTGTCCATGCACTATGCAGCGTGC
AATATTAGCACCAAAGTCAAACGACAAGCGATGTGAAAGACCATGCTAACAACCAGTTTAACCATAGAAACAAACGAGGCTTAACCAAAAACGCCTGCCT
CATGCTTCTCCAAAGATACTCATTAGGCCTCCTATGCCGACCAGCCAAAACGATGAGGTATTTTAGTGCAGCGACGGCTTGTGCAAGTTATCTATAGGGA
GTGAAAGCCATTATCTATACAACATGCGTGGAACTGGAGAGGGCCTAGACAGGATAACATCCACGACATTTTCAGTCGAAATATAGAATCAACTAACACG
ATTCTTGTGCTGCTTAATTTGCCAGCACCAAAAGCTCTTTCTTACAAACAAAGAGTTACAAGATATCGACAAGAGGACGACATCTCGAAGCTAGCGTTTA
TATACGGATATCACCATAGTGACACCGATATCAGCAGAGCAGGACGGCAGTGTGCACGTGTTGCAGCTACCCGTCGCATAGGGTACCCTATTTTCACCGA
GAAAAAGCGCAAAGTCTTTGTGCAAGTGTCCGATATCTTCTACGACACCTTCATTCTTACGTTCAGCAACATGTCCGACCCCTCTCAAGCTACCGTAGTC
TCGAACCTATTGTAGGCATGAGTGTAGTGAGGTGGTTACTGCTGCTGCTGCATCAACGGACGTGGACCGACAGATCTCGGATCATGAGTCGCTTCGCTCC
CAATCAAGCGCTCTTAAATGACCCAATGATAATAGCCTGGCGGCTTCTAAATTGTTGCCGTCGATTGCTGGGACACGACGGCAGACACTCTCTTTCCCTC
GTTAAACTGACTGTTGAATGCGAAAGCAGTCGACGGGTGCCAAAATAGAAAAAGTAATCAGCTTATGTTGCCGTACCGTCGCAAATTGATCCCAGTTTTA
AATATTTGAATGGCGCGCAAATAACAGGTGCACAAAACTACCACATACCAATTACAAGTGTAGCCGAGAGTGATGGTCTGGTTGCACCGACCGACCCTTC
CGCACTCGATCAGCTTGCCACATACCGAAATCAAGTGTAACGCGCGACAAACGCTACAAGTAGTGCGGAATCGCCAACGAGCCCGCAGCGTCATTTCCGC
TTTGTCCATGCCGACCGCACGAACGTCCGAGGACCCGGCGCTCTCCAGCCGCAAGCGCAAAACCGATGACTTCGAGTGGGAGGCGTCCAAAGAGAACGTG
ATGCCGCTCAAGCGCGGCCGCAACGTCGTGGACTTGAACCAGGCGCTGCGTGCGCACGACTCTGTGCAGACGAAGCTCCGACTGGAGACGGAAATGAAGA
CCAGGGAAGCGGCGATTGCGGCGTACGCGGGCGACGACCCACTGGCCCATTGGCTTGAGTACGTGCGGTGGCTCGAGGTCCAGATGCCGGAGGACACGCG
GAAGAAGTTCAAAGTCTTGGAAAAGTGCACGCGCGAGCTCAAGGACGATCGGAAGTACCGGAACGACATGCGATACGTGCGGCTCTGGATCCAATACGTG
CGTTCTGTACTGTAGCAGGTGCTTCTTGTGGCAGAACTTGAGGCTGAGAGAGTCGATCGATGGCTTTTGTGTGGTGTAGGCGGACTTGGTGTCCAATCCC
AAGGACATTTTCCGGTACTTGTACCAGAATAAGATCGGTGAGCGCGTCTCGCTGTTTTACATTGGCTGGGCTTACGTGCTCGAGACGATGGCCAGTTACC
CCCAAGCACACAAGATCTACTTGAAAGCCAGCCAGAAGTACGTGATCTAGATCAATTTCTGTATCGATTGTTATGAGGGAAAGTGTGGCAGGAGTAGTTT
GAGACGAACGATGCTGCTGCTGCTGCTGTTGTTGTTGTTGTTGTTACAGGAAGGCAGAGCCGCAGGATCTGTTGGAGAGGAAGTACAAGGAATTCCAGCG
GCGGATGAGTCGCCAGTGGTTGAGAATGAACGAAGAGACTGGTGCTGGCGACGTGAGTGAGGTAACGCATCGCCATGCCCTCGAGAGCTTGTCTGTGTAC
GGAATGACGGAACTAAACGATGCACAGCGTGAGCAGCTACACCATCACCACGCGTCTGCTCGGGCTCAACGGGTTCAGAAAGTAAATGCGCACAAACCGG
TATTTACTGTGTATGAGGACCCTGTCGTACGCCATGTCGATCCTTTTTGCGGTAACGGTGAGTGGAAAAAGCTTGGTACCATGCAGCAGCAAGACAAGGA
AAATGAGCTGGCACCCAGCGCTTGGAATCCACCAGCTGCTTCTACAGCTACTGACTCTGGCCATAACCGTGAGCGTCTGCCCTCGTACATGTCGAGAAGC
CATCCACAAGTCATCTCCCACCAGGTCTTTGTGGACGATGAGTTTTCTGTGCCTGACAGCGAAACGAAACGACGAACATCTCTAACACATCGTTCTCAAA
CTCTGCGACAGCGTATAGAAGGAGTGGCTACGGAGGAAGAAATGCTTGCACGAAAGCCGCTGAAGAATTTTACAGCCAGTGAGCAAAAGACCCGGGTAGA
AAAGCAAGCTTCAAGAAGCAGGGTTGAACAGCCCTGTTACGATGTTAAGCAAACCATGTCCGACGCAGGCGAAGCCATTTCCTTCGAAGAAGTTCGAGCA
CGTGCGTACAAGCGCGCTAACGATAGACGATGCCCGGCTGGTCAGCAAACACTTCATGATGTGTCGAGCAGTGTCGATTGTACACCTAAAGTAACTGCAG
CCCCGTCTATATCAACCACGTCGGCGACTGTTTCGATAGCTTCTCACGGATTTCTGCTTTCAACGCAAAAGCCTGCTATCACGCTGTCAAAATCCCGTGA
CGAAAAGCCTACCGAGCGAGGGCTGCCACTGGTATCTGGATCAACGATGATTAGTGGAACGGCTGAAGCGAGCAACGCTGACCATGACGACATGACTATT
AACACTCGTGTTGCGCTGGAAGACATTAACAAGATGTTTTGCAGCCCACCGAAACAGCCTAAGGATACTGTTTGGGAAGTGAAGGAGGATGATCCTGTCG
AGCGGAAGCTTCACTTTAGTGTTTACGATGATTCGGTTGATAGCATATCAGTGGATGCACAGGATCAGTCGCTGTGTCAAGACACGAACGAATCTATTCC
GACGCAGTCTTTCCAGGTTTTCACGGATGATGTTTCCAAAGATTCACGGATGGAAAGAAAGACTTGGAGTCAGAAGAGGAAGCCCCTGGGCATTCGGGAT
GATCTGGTACGCGTCGGACGTCTGACGAACAAAGACGCTCTTATGCAAGCCGAAAAGGATGTCGCTGCGAAGAAATTGCCTGATAGGTAGATGAGTCGTT
GCTTGCTCGTCTACATTGCAACCTTATTATATCGGAAGAATCTGTCATTGTGAGACTCTGCTCATTGACCAGCGTTTGTTATAGCGGCCGAGTGCAAGAT
GCTATGAAGTACATAGCACGAGACCGACCACCGAGGTATCGTTATCAAATCCGCTGCTGGTCGTCTGACTCGCAACTCTTCGTATCACAATACACAACTT
ATGTCTCGTTTGACTAACATTTTGACGTCAAGACATATTGTGCAGCCTACTGTTGTACGGCCCAGTTCGAAAGCCTGCAAGTTAGATCCGTACACTCACG
AAAACCGTCAAGCTCTGATCCTTGATCAGCGAGTTGACCGGTATCTGTGGTCGAGACCTGATGCCGTTAAAACTCACACACAAAAGCTGCCACGATTCCC
GTGCAACAATCCGGCCAAGCGGAAATTGCAAAAACCAGTTATCGTCAGGGCCAGCCACACACTAACGCTTCAGCTTGTCGAAGTGCTAGGTTCGGGTTCG
TTTGCGCATGTCTTCTCCGCCAACGTTGTTGATACGGCAAACAGCATCACTTTCAGCAAAGCTATCAAGGTAGACTATTGCCGTGCGCTGCTTCTATGTG
CAGCAAATTCTTGACGCCGCTACAGTTTGAAAAGGAGCGCCAGAATCTAGCTTGGGAATTCTACGTCACGAACAAGATCATCAAGATCTTGCGGAACAAG
AAAAAGCTTTCGGAGGAGAAGATTCCGGTGCCCGCACTCAATGCACTCCAC