Description :
From Genome Similarity Track
Location :
scaffold_1088:4855- 5942
Transcript NameFunction/comments
Pl_101346hypothetical protein PHYSODRAFT_557583
Pl_101347conserved hypothetical protein

Sequence
1087 bases(100 bases per row)
TCCGGGTTGGTCGCCTCTACGCGAACTACGGTGTCGTGGACCCGGAAGCCAAGATCTTTACTCTTAAGGAGGCCAAGGTGGTGTCCGAGGCAGCGACCAA
AACCAAGGCTACCTAAGCTGTAGGTTTCGTTCAGACAGGCTGAGAATAATACATGTAGCAAGTGATCCTTCGACATGTAGGTTTCGTGCCGTTTTCGTAG
AGCACGCATGTGTGCTCGTGCTTCACAATGTGCAAGGTGGATGTATCATCCACAACAATCGCTGACTGAGATTCACATGATATTCATCCATCTGCCAACT
ACGTCATTTGTCTGTCGTCTTGGCAAACCCATTGAAAGCGGACAGGCTCTGTTGATAGACTAGATCATCTAGGGAATGGAAATGAAGGCAAATAAAATGA
TACGAGGACAGCCTTCCACTGAGTTGCGAGTTCGTTAGTAGACGACGTTGCTCGTCGACGCACGTATATGATCGTAGACACCAGAAGGGGAGAGCTACTA
TTCACATGTGCTACGAAATCTCCCCGCGTTCAACGCAAGCATCTATATGCATGACAACACCGAACACCCAACGTCACCTTCCTTCCATACTTGCACCGCG
CCAAGTATTTGTATTCACGAGGTTCACGCAACCAACGCTTGCCCATGTTCAAAAAGTTTTGCACAGTCACTGTATTCTCCTCTGTCTTCTCGGAGAGTCT
CTCCTCCCACTGGCGATAACTTAGAGCAGCAGCACGTTCTCCTTGGGTGTCATGCCCCCACCACCGCCACCGTTATTATAGCCCTCCATTGCACCAGCAC
CAACAGCATCAGGCGTTGCCAGTTCAGCCTCTTTGCCCTTCCTGAGCAACCGCGCCCCGGCTGCAATAGCTACCACAGCTAAGCAGCCCACGACGATACA
CATGATCGAGCCAATGCCCAGTCCACCACTTCCGTTGGAATTGGACGAATTGGTGCCGTCGCTAAGAATCGATCCAGGGTTGAATGATTGCTGGTTCGCT
GAGCTGCTACCAGGTGAGATAGTGACATTACTACCCGAGCCAGAATCGGATTTCCACGAGTGGGATGCAGAGCTGGAAAAGTTAGAA