Description :
From Genome Similarity Track
Location :
Scaffold_78:48540- 51221
Sequence
2681 bases(100 bases per row)
TATGTGATTCCCGAACTTCTCAATCATGAAGCTCAAAACCTTCACAGGCTTGAAGTTGGAATCATTGACAACGGAGGGCTAACAGCGACATCAATTGTCA
CAGTTTATATTGACGACATCAATGAACGGCCGATCATCACCGCAGTGTCTTGCGCGGTTTTCGAGAACGTAACCACTGACGAGAGTATCTGTCAGATCGT
TGGGGTTGACCCTGACTCGGACAGAAGTCTGAACGGTACCCTGACGTACAGCTTCAGTGGTCCCAGCAGAGGTTTCACTATAGATCCTGCGATGGGATCG
ATTCAAGTCGTCTCAAGTGATACACTGGACTATGAACTAGCACCAATCaTAACTCTGAAaGTCTgCGCGACAGATCAGGGATCTCCTCCAcTACAAGATT
GCGGCATCGTTACGCTCAGAGTCAAGGATGCAAACGACGCCCCGACCCTGATCTCCCCAACAACGTGTCAGGTCGATGAAACGCCGTATACGCTCGACAA
CCAGACGTTATCTACACTTGGGGGAGTGACGGTATGCAAGCTCACTGTCATGGACCAAGACTCGACTTCCCATGCGTGGGGACAACATCACTGGGAGTAC
TACGTGTACTCAACACATCAGACCTCGCCATTCCACGTAGTTCCAACAAGCGGCGAGGTCATCATGACAGACCCGACGCGCGTCGACTACGAAGCAGCTG
GGCACTATCACATTCGCGTTCGAGCTACTGACGGTGGGAATCTTAGCACACCATGGCATGATATCGACGTGATTGTTTGCGATGTGAACGAAGCACCATC
GATCCAAACGTTCGCCGGGTTTTCCATCGAAGAGAACGCCAAGCCAGGAACCATCGTATCTCAGGAAGTGGCTCTATATGACCCGGACATGCTAGATGAT
GGCACACGTGAGCCAGTGAAGCTTGTTGTTATTGGCGGAGATAACACAACCTTTGCTATAGCAAACAAAAaTCTACTGGTTTTGCTGGCGTCCGACATTG
ACTACGAAACCAGAACGGTTTACAATCTaCGCACAGTCGCTGTCGATAGTCGGGGTTTGCAAAGTGCTGCGGtGACATTGAATATCCAAGTGCGTGATGT
GAACGAGGCACCGAGTTTCtCAGCTACTCAATATTCCTTCTCGATCGaCGAAAACTTGCCGGCTCAAACCAAGTTGGCATCTTTGATACGTGCAGAGGAT
CCTGATACGGCCGATATTGTGACCTACTCTATCACCAGCGAAATCACGGAGAATGAACCTAATGATGCCCCAAGGACGTTTGGTATAGATCCATCGAACG
GACAAATTTACCAGATTGTGGCCGGGCTCAACTACGAGGCTGTGTCTCGCTATTCTTTGATCGTGAAGGCAACCGATAAACTTGGACTCTTTGCCACAGC
GAACGTGACGATTATTGTGAATGATGTAAACGAAGCTCCTTCTCTACCAGATCAGAGTATTCATcTCCCTGAAGACTTTGCGATTGGCGCAGAGATTGGA
GTTGCGTATGTCGCACTTGTGTCGGATCCTGAACGCCTGTATGAGAAGTTCATATTCAGCGTCGTCAGCGGCGACGGTGCTGGCTTATTTTCACTGGACA
GTGATACAGGGCAGCTATATCTAAAGGCGCCTCTGGATTACGAAACCGCGTCTCAGCATGTTCTTGGTATTCAGGTCAGAGACCATGGTGGGCTTTCTGC
CCAAGCGACATTCACGCTCACTATTGCCGATGTGAACGAACCTCCGCAGATCATGACATTTGACTTTACAGTTAATGAGAACTTGCCCCCAGGATCTTTA
GTAGGCTCACCTGTTATAGCCTCTGATGTCGATCGTGGCTCAATACTTCGGTTCTCTATTACTGGCCAAGCGAGTAAATCAAACATTACGACGGACCCTT
GTTTtCTTATCAACAGTACATCCGGTCAGCTATTCGTTTCAGCTGGATGCGTGTTGGATTACGAAGACCCAATTCGCTCTTTTCTCCGCCTCCGAGTGGA
AGTTTCGGATGGTGTGTTGACTGCTACCACGACAGGTGTCGTCCGCGTTGCCGATTTGAACGAGGCTCCAATCTTTGATCCATTCTCGCCAGTGCTGCTT
GAGGAAAATGCTCCAAGTGGCACCGTAGTCGTTGCCCTCAAAGCACTTGATCCAGATGCCCTTGATTTACTAACATATTGGTCATGCGATCAAAGTCACC
CAGGAGCTTTCGCTGTCGCTGGACAAAGTGATACGACCTCCGTCAATTTGATTGTGCTAAACAATATGGTGTTGAACTACGAAGCCCAGCCGAATCTTTG
GGTCGACATCTGTGTTCGAGACATTCAAGGCCTCAGGACTAAAGAGCGATTAATTATTCAGTTACTAAATGTGTATGAGCCACCGCACTTCACTACTCGC
TTGATCCCGTTCGAAGTCAGAGAGGATATCTCCGTCAACAGCACGATTGGTACTCCTCTCAGCATCTACGTATGGAACGAAGAGCAACTTTTAACACCGG
CCTTTACGTGCGCTGCTTTCGTGTCACTTCGTGTTATCAACCATTCGTGCTTGTCGACGATTCAAGTGAACGTTGACGGATGCGGTCATTTGCAGCTCGT
TGGCGGCCAGTTTGACTACGAAACGCAACAGAGCTGCACTGTCACTGTCGTTATCGCGTCATCACAAAGTGATTACACCAC