Description :
From Genome Similarity Track
Location :
Scaffold_136:4854- 7018
Transcript NameFunction/comments
g17787.t1hypothetical protein
g17788.t1XP_009514637.1 hypothetical protein PHYSODRAFT_462863, partial [Phytophthora sojae

Sequence
2164 bases(100 bases per row)
TGTAACGGGGTACACCGACGTGTACCCATGTTACATAAAGAGTGACGGGATGTCTCTCTTTTGTGCCCATGGTACGTGGTACCGGTTGGCGGTGAGCCAA
CCATTGGGCACTTGTTTAGCTTTTACTATTGTTGACTTAGAGTTTGTAAGGATCAAGCTTGACTCACCTATAAAATATATTCAGTCTTTAAACCTACCGT
CTAAGTCGTAGTCGGTTCCCTTAGACCGTGAACCGTGAACTTGTTGTTCACCGAGAGCTTACGCTCTCTAGCACTTCCTCTGTGCAAGGTGCTGTGTGCC
CCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAAGACTGAACCACTATGGAAC
GAAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGATGTCCTCCGAGGCTTGGCGTCGGTGAC
GCCAGCCGAGCAAGTCGAACGCGTGAACGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAAGGGAAACCTGCAGGCCTCTGTGGCCGAGCC
GAAGCCGGTCCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGGGAAGGAAGGTGAAAACCTTCACTTCTGGATCCGAGAAGTTGAGATCGCC
ATGAGGGCGGGTCTCATCTCGGATCAGGGACTTCGCGTTGCGTTCGCGTTGTCCAACCTAAGCGGTCGTGCCAAGAATTGGGCGTACACGCTGGAGACGA
CGTCTCCTGGATGCTTTGCATCCTGGAAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGCGTTCCGCCAGCGCTCACGCTTCCT
CGCCTGTAAGCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCCCTGCCCGAAGACGTCAAG
ACGACGGTCTTCATGGACGGCCTGAAGGTCGGTCCCGCACGCACGCAGTTATTCCGCGTGCATGCATCCACTATGGAGGAGGCGATTAAGATCGCCCTCC
AGGAGGAGTACAGCCATAAGCAGGCTGGTACTCCGGTTGTTGCGCAACTTGTCGTTGCGAACAACGAGCCAGAGCCTATGGACTTAAGCTCTGCTGAGCT
TGGCTCGGTCCGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGCGTGTGTCCTTCGACTGGGGTGGGGAAGAACCCATCCCTCAAACCCCGAGGG
CCTAACGGTCGCTGGCGCAAGCCGCGACCAGGTGGCCGAGGGAACTCCGGCCACCAGTAATGGCGGATTCCCCAGAGGGGGGAGAGTTGAGTCTCCGTGA
CGGGTGTGCGGGTGGCGCACACCATGGAGGCTTAGCCTACGAGAGACATTATGTCTCGAATCGGTGATGGCAACGCTGGGTTGCCGTTAGTACACGTGAG
TGTACGGGGATGTTAATATCCCTAGGAACGTTTAGTTCCAGGGGCGTCGAATGCTTTCGTACGCCGCCGGAGCGATTGCCAACTCTCTGTGAGAGAGCAT
CGGCAATGGTCTGCATAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTGGTCGTGGACACGTACGGCGTCCGCTTGGGTGCGCC
GTGCCATGAACGCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCTAGGCTAACCGGCACCCAGCTTCTGGCAGAGCATTGGTGAGTCATGATCCCA
CCTCTGCCAGAACACGCGGTATCCGAAAGGATTACCAGGACGCAATGGCGTCCGCCGACGTACGGAAGTCGTCGGAGTAGTTGCAGCTGCAACAGGTGTT
GAGACACCGTCCACTGCGGGCAATGGACCGCCACAGGCAATGCCGGTGGACAGGACTAATAGTCCAGCGAGGGGAGCTGCAACGCCAGCAGCACCCACCG
CTCCTGATCGTGGCGCCATACAGGCCTCGACTGTATCAGCGCCAGGGGATGTCAGCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTCGAGACC
GTGGCCAGGGCTGAGGTTGCCGAGAGCACCTCCTGTGTGGGTAACAATGTTCCACACGGAGTCG