Description :
From Genome Similarity Track
Location :
Scaffold_105:48534- 51792
Transcript NameFunction/comments
Hyaar_Emoy2809606hypothetical protein

Sequence
3258 bases(100 bases per row)
AGAAGTCTCTTACTAGTGATACGGCCTAAGGCGACCGACGTAGAACGTAGTATGCGTGCGCATCTTACGTGGCAGTTCAATCGTGTATGCGTTACCTAAG
CGGCGCAGCACACGAAATGGACCGATGAGCTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACCATGTGTCAAAGTAGGTTTACCGTAGATAGCAGGA
CTAGGTCACCTTCATTGCATGAAAGGTTGTTTGCTTATCCATTCTTGTCAGCGTTTTTCTTGTGTCGGTCCACCGCTTCTGCAATGGAATCTTGCACGAA
ACGGACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGCTATAGTGCGCTTGGAGCGCACTGCGGCAAGATCAGTGACCTGG
GTAGAAAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGTTCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGATG
AGTGAGAGCCGAGTTGGCGTTCGCTCGAAGGATTCCCCCCCCCCTCAAACTAGAGTTACACTTTAAAAAGGTGGGTAGGCGTGGGTGGCGCAAGCCATTC
ACGACGAACGGTGTATGAGTCGTCGATGCATGCACCGAGTTGTTGATGGCAAATTCCACCATTGGCAAGAAGTCGCTCCAATTCGTAAACGAATGGACAT
AACCCCGAAGGATTTTCTCAAGAACGCGGTTGGCGCGTTCTGTCTGAACATCTGTTTCAGGGTGGCCAGAGGTCGACATCTGTAGGCGCGTTCCGAGTGT
TTTGAACGCGGATCGCCAGAATTCCGCAGCGAACCGTGGGTCTCTATCGGAGACGAGTTCACGAGGCAACCCATGAAGACGAAATATCGTGTCAATAAAA
ACACGAGCACATGCCGATGCATTGATAGATTCAGGTACAGCGACCAGGTGTACCATTTTACTGAATCTATCAACGAACACAAGAATACGGGTATTCTTGT
GTGGGTCTGCGGGAAATCCAAAGCCAAAGTCCATTGAGACTGATTCCCAGCATTCTGCTGGAATGGGTAAGGGTTGCAACGGCGCACGAAGTGAAGGACC
AGACTTCACTCGTTGACATACTTCGCATGTGCGGACGTACTTACGCACGAATTGATACTGGTGGGGCCAGTAAAAGTCGCGACTAACTGTGAGATACGTC
TTCTCTCGACCACGATGCCCACCAGTAGGTGCATCGTAATACTAATACATGATGCTCAGTCGCAGGTCACCATGGTCCGGTACGACGACACGAGGCGTGT
CTCCGACAACGGCTGTATACTTCAGTCAGCCATTGTGGACTGTATATCAATCCGTGGAGGATCGATATACTGGGGGCAACGTTTTAAGGGATTGACGGGA
TGGTTGCGAGAGATGTTCCATCAAAAGCACCATCGCCGGATCGTACGCCTTGCGTATGTCTTCGAATAAGGTTGAAGAACGGGACACTCGACTTCAACAC
CGCGACAGTAGTCGGACCAGTGTCGGGTTGCGCAGCCGGTTCGAAATCGGGCCGGCGCAACAGAGCATCAGCGACGACATTCAGTCGTCCTGGCTTACGT
TCTACGGAGAAGTTATACTCCGCTAGGAACGACATCCACCTCGCCATTCGCTGTGAGAGCTGTGGACTGTAAACGGCCGTACGTAAGGACTCATGATCCG
TGTAAACGATGAAGGGTCTATCCCCTAGCAGGTAGACACTGAAATTTGCCAAAGCATACTTCATGGCAAGGAGTTCCTTGTCATGGACTGGATAGTTACG
TTCAGCCGGTTGCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCGTCACACTGCATCAGTGCACATCCGATGGCAAAATCAATTGCATCGCAG
ACCACATGAAATGGTCTGTCTTAGTCTGCAATTGCCAAAACTGGAGAGTGTATCAAGCTTTGCTTAATACCTTCGAAGGAGCGCTGGCAATCAGCACTCC
ATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTATGAGAGTATTTGTGCAAATACGCCGCTAGGCCAAGGAA
CTTTCGAAGTCCTTTTATGTCGGTAGGCATCGGCCAGTCAGTGATCGCCTTGATCTTTTTCTGATCGGGCCGGACGCCGTGCTTACCCATGATGCATCCA
AGAAGTGGTATTTCGCTTGCAGCAAATATACACTCCTTGAGGTTGGCATACAACTTATGGTCACGCATCAGTGTATGAACCTTCCGGACGTGGAGTCGGT
GGACTTCCAAATCCGTCTGTCCATCCATAGCCCGGGTATGGACGAACATCGAAATAGCTGGGTACGAATTCTCGCACAGATCTCAACAGATTCGTAACAC
ATCTATTGAACGTAGCAGGGGCATTACTCAGACCTTGTGGCATTACTAGCCACCCCCAATGCATACCGCTTGGGGTGCTTACTGCTGTATAAGGAATGTC
CTTTTCACGCATAAGATAGAACCCGTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGACATACCATCTATAATGACATCCTTTCTTGGTATCGGC
GTTTGAGCCGGTACAGTGGCAGCATTCAACTTGTCGAAGGCATGTACTATCCGCCATCCTCCTGTGGCCTTTCGGGCACAGAAGGTCGGAGAGCTATGTG
GGGAAGTAGATTCCCTCACATGGCCCGCTGCCAAGCGATCGGCAAAGAATTTGTCAATCGCTAGTACTTGTTTTACGAGGCAATGGCCATTGCTTCATGA
CACAGTACTTTGACCCTGGTTTCAGGTCTATCTCGTGACGAGTACCCTTATCCTTGGGTAGCTCGCACGGCACTGTTTCTGGGAACACGTCCCTGAATTC
TATAAGATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTGTATCGCTCAATCCGAGTCTTCTCATCAAGGACACTCTCGTCCATT
GATGAGCTGCTGAGAACCCTTTCGTTCTCAGCGAATACCATTGCCGACCAAATATCGGTTACGTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGA
CTTTGCCACTACGCAGATCACGCAAGAACCTTTCCTGTTCGAGCGTGGGCAATTGAATGGTCTCCGAAGTTGTCTTCGGAGGCACGATCAGATCAAGTTG
GTATGTTCCTATGCTTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTTGTCTCC