Description :
From Genome Similarity Track
Location :
Scaffold_134:48533- 65643
Transcript NameFunction/comments
Phyke_g4786ATP-binding Cassette (ABC) Superfamily
Phyke_g4787hypothetical protein
Phyke_g4788hypothetical protein PHYSODRAFT_466741
Phyke_g4789mitogen-activated protein kinase, putative
Phyke_g4790hypothetical protein PHYSODRAFT_566560
Phyke_g4791hypothetical protein PHYSODRAFT_534432

Sequence
17110 bases(100 bases per row)
TACCATGTGGTCTGCAATATCTTGAAGATCCAACAAGTTTATGATCTCGTTCACGGAGTTGAGTTTTGCACTTGCAGACACTTCACTGTCCTGGCGAAGA
AACGCGCTAAATGCAAGCGCCTCGTAAATTGTCGCTGTTTGCGAGTGAATATCCGTCTGCTCGCAGTAGCCCGTGCACCTCCGGATTGTGAGACTCGTCG
CCTCGTGGCCATTCAGCAGAATCTTGCCTCGAACAACTCCAGTGTTCTTGCGACCCGCAATGACGTCTATGAGTGTTGTCTTTCCCGCACCTGACGAGCC
CATAAGAGCGGTGATTGTACCAGGCCGTGCTACTCCACTGACTCCCTTCAGCAAATCGATGGTCTCGTTTGTGTTGTTTGCGTTTGGCACCGAATACCAA
ACGTTCTTGAACGCTACTGTAACAGGCTCAACTGTTTGAGGGTAACTATGGATGTCAATCACTTGAGACCCATCGAGCATGTTTAGTGAAGTCGCTGGAC
CGTGACTGCGGTGCTTGGGGGTCGTCGCGAGTTCGTAATGGCTAGAGTCTTCTGCCTCCTTCGATTTCGATCTGGTGGGGCTGAAATCATTTTCGTAGCG
CTTGTACTCGAGCGCCAAGTAGCTGAGTGCCATGAACAAGAGGGTTATGGCGATGAGATAAACAATCCCGAAGACAATCCATTCTCTCCCCGAGGAGACG
TCGTATACACTCAGGTAATATTCACCCATAGTCTTACCGAAGTCACTGCAGTAGTCGATGTTGTTATACTTGCACACATCCAGCGTTGAAGATCGGTACT
GGCTCACGGCGAGTGCACGGAATGCCCAAGACATTGGATTGATCCAATAAATCCAAATGAGATAGTCTGGAATTTGACTCCGCGTCACAACAAACCCTGC
GAAGACAAGCACAAGTTGAAGAATGCCCAGCGCTAGTGGATTCGCGATGTAGATATTCGGCGATATCGcagcaacgaagaagaagatcatcactgctgcc
atcacgGTGAGGAAGATGATCACCTCGTATAAGATGAAGAGACCGGCGCTCGCCTCAAGTCCTGTAATCCAGTACAAAAATGCGCCGTAGATGAAGCTCT
CGGGTAGTGCTGTCGGTATTTGGCTGATAGCACTTGCCAAAACGTATGCTGGTGTCTGGAAGAAATTTGCTGAACGCTGCTTGTAAAAAATGTCGCGCAT
ACTGACGAACATGGACAATTGAGACGTCTGCTCGAAGAGAGGGAACAACGTCGACATAAGGATTACCCCCATCGTCGTTGAGGCATTGGTAACTTCCACG
TTCATGAAAGTCGTCGAGGAAACTAACGCCGCAATCAACACGAGAATAACTCGACTCCAAAGCGTATTGACATCACGTGAGATAAGTGTGAGTTGCCGCT
GAACAAGCGTAGGAATGTTGGCCCATACGCCTCGCAGATACTCTGGCGTTGACTTGATATATCCCTTGATCAACGAGTCGCAATTCATCGGCTCATCGAA
GCGCTCAAGCATTCCTCGGTGTACATCGGAGCAGCGAAATACTTCCGCATATTTAGTTGATAGTCGAGGAGGTTTCATCCCGCTAAGAGCACCCCTGCGC
TCATAGACAGATTGCTGTGGAGTTCCAAGATCAAGTAAGAAGTCAGCGACGTCTCGATTCGGGAGACATTCGAGACCCAACTCTCGGAAGTAGTCCACAA
TCCGGCCGCGGGGTCCATAGTACATCACCTCTCCATCATTCAGAAGGATGATGTCATCAAAGAGTGCAAATACCTCCGGAggcggctgcagcaacgagat
caCCATGGTTTTGCCCAACCTGTGCGCGATAGTTCGCTGTGCATTGATGATGTCGAACGTCGCGGCACTGTCGAGTCCTGTGCTAATCTCGTCCATAAAT
GAGGCTTGATGCATACCTTGACACATTTCACCCGTCGTCACACGCTTCTTCTCGCCACCGGAAACACCGCGCACCATGCCATCACCCACCATGGTATCCC
AACAGTTATGCAATCCGAGCTGTGTCTTAATGACCTCCGGGTAGTGTGCAAACATGGCAAACGCGGATTTCAACGTCTGACGGTCTTCATGACGAGAATC
ATGACCAAGTAAGGCATCGGCGCGTCCTGCAAGATCACCCCCGCCACTAGTACTGAAGGCATGCGCAAATGACAACGTCTCCTTCACCGATAACAACGCG
AAGTGTTGATCATGCTGCGGTACATACGCCGCCAACTGCGGCAGCTTCGCGGCAACGAGGTGCTGAGGCTCGCCATTGTACGTTATCTCACCCTCCACTC
GTACGCGGTTCCCGTCAGCACGCAACTTTCcgctcagcagcttgagcagcgtcGACTTTCCCGATCCTGGTTGACCGAGCACTAACGTCATGGTCCCTGG
ACGCAGTACGCCACTCACATCCTTGAGAATCTCACGCGTCTCTGTCTTCCTCTTTGACACAAGATCAGCGGCAGTATTTTTGAGTACGTTCCAAATCGTC
GGAAGTTCTGGAGAGCTGCCCTCGTGTTCTCGTGGCTGCAACGTGGCCACCTTGCAAGACACCGTGACGTTCGAGAAACGAACTTCCAGCTGCGGCTGAT
TTTGTCCGAAAACTGCCTCGAGTTTACTCGCAATAGACTCGTAGAAGACTTGAGGATCCGTGATGGCGCTCGCCTTCGTCAGTGCATCCCTGGGTTGACT
TGTGCCTACAGTGGGTTCCATGTCGGTAAAACTTCACCCAGTTGCTGTGAGGTTGGAGGCAAATTGGGAAATGACAGACTAGGATGTGCTGGCGTCGAGC
GAGTGCTGCCTACACCAGAGAGCTCTACATGTTTAACAATTGCTTTGATGACGTTAATGCTGCAGTGATGCAATCAAATTGTAGATAACGGCGACATTGA
TGTCGATGCGATCCAACCCTAGGAATGTCCGTTTTTCAAATCCGAGTCTCGAATGACGTCGTCGTTAGTGTCGATGCATTCAAATGTTTAGTTGTAACAG
ACACTGGGTGGTGACACCTACTTCTCAACAACATGATATCGTTGTTATTTGTCTGCCAtcctcccccccccccctctctCGGTAGATTGACATTTGCTTT
CGTCAATTTCTACCGCAATGTTTGGCTCTGTCCCTCTCAAAACGTCCGGCTTTTTCCTGCTAATCGCCTCACTGTCCCAATTCACAATAATGGCCAAGTC
TGGAGCGATGCAAGTCCGTGTGACGGCGTTCCTGCGCCGCGGTGTGTGGGAATTGCGCCACGGCCAATGtcgctcctcctccgtgagTCTACTGCTGCTT
TTAGTGCTCTCAATTCTGAGTCTGTGGCTCTTGATGGCCCCAAACGCCAGTTTCCCGACTTTGTCAACACCCTCCAGCCTTTGGGAGAGATTTACAGCCA
GCCGTGGAGCGAACGCTCTGCGGTGGGGCGTCGGAAATGACGTCGTCATGCTAGATGGCCGGAAAATCCAACGTCCCATGCCTGGAAAATACCCCAACGG
AGACCTCAACAAGTTCAAGTGTGACCTGCCGTCGCTACGGTATCAGTGTGATCTGGACGGAGACAAAGGGTGCCGAGGTTACCCACAATTGTTCCCGTCG
GGCGCATTGTTTGAAAATTGGTCCCCGGATAATACTGCACAGATTCCGAGCGGGGTTTTCGACAGTATTTGCCACTTTAACGTGTCGTCTCCGGTGCGTA
AAGCTTTCGTGGGTGGTGAGGTAGTTGACGTAGCGGGACTAACTCACGGATTGTGTGCAGTATGAACTTCGTTTGGCGCAGATGTTCCGAGAGATGGAGG
TGCCTTTTGTGGCCTATGGTGTACCTGAGCTAACGGCAGCGTCGGAGCGATGGACGGACGAGTACTTGACGATGCAACTTGACCCGAAGGCGATGTACAA
GGTGCATGTGGCTAACGACAGCCACTTCATGTACTACTTGAAAagccagcaacttcaggGCGAGAAAGCCCCGTATGAGTCGCGCTGGATGACGTACCCG
CAGTTCGTACAGGCTGTAGACGACGTCAAGCCGCTCGAAAGCGTAGGCGAGCCCCACGAGTACTACTACTTCATGCTCAAGACAAACGATTTTCTTGGGA
AAGCGGGGTTCATCTACAAGGAACTTGATTTTTTAAGCCCGCTGCAAACGGAGCACGATCCGCGCTTTGGAGACTTGTTTATTCGTGATGTGAAGTTAGC
AAAGGACCGCGGTATGCGCTGTCGCCTTGGCATGCGAGGCATCATCGCTGAGGGCCACATTGACGGTGGACTCAACATGATCTCAATGATTCGTGGAACT
AAACGCTACGTCGTGTCGCCGCCCAGTGCCTGCAAGTGTCTAGGCCTCTTGACAAAAGGGCAATCTGCGCGCCATACGTCATACAACTGGTCGGACGTCA
GTTCTTTGCCGGAAAATGCTCGCAATTGTCCCGCTGCGGAGGTAAGTCTCACGGCCGGCGAGGTCCTGTATCTCCCGTCTTATTGGTATCACCACATTGT
GTCGCTGGACACTAGTATTCAGTGCAACCTGCGCTCCGGTTTCAATATCCGCAACGATACGAAAAAGTTTCTCGCCGACTGCCATGTCAGCAACTAGCCG
ATAGAAGGATGCGGTGGATGACAAGTGAAAGaaatgaagaagcgcaaaTGCAGCTCTTTTATGAGTGTTATTGTGGTTTCGGTGGTGTTCAGACGACTCA
AGTACTCTACAAACGTCGAACCCCTGGTATGGACAAATGCCGTCATTTACGCAGAGACCGCGCCGTTGacagtcgatgcagcagcaagggCAAACTTGTC
CTGTGAATCCGAGGTTAACAGGCCGAACGACTTCTCGAACGCTTGAGACTTGTAGGGGGTGTCGAACATCTGGAAGTAGAAGGATTCTTTCTGTGAGCTA
CTCCATGCCTTGTAGTCTGAAAAGAAGGTCTGTGCACCCGCCGTGCTGCCGATGTTGCCTGAAAGTGATCCTTCTGATGGCCACCCTGTCTCCGTGATCA
TCAGCTTGTCACCAAAATTTGCCTTCATGATCGTCCACTGGTTGTTGAAAACGTCTATCGCTTTATCAGCTGTCGTCCCCGGGTTGAAGTACGGGTGAAG
GTTCACGCCGAGGACATCGCAAGCAGCTACGAGTTCCGACCAACCGGAGATACCCGAGTAGTTGATAACCTCCGTGTTGCGCTGCACGGTGCCAACCTTC
ACTGTGGGTGGTACAGAGGACTTGATTGTACGAACCACACTGGCCATGTCGGAGGGCACGGTGGTAGCGTCCGCCAGATTTTCATTGCCCACAAAAATGT
AGCCCACACCGCCAGTTTTAGCTGCCGCGATAGCAGCTTCCATTTGTTCCGTGTAGTCGGACTGGGGGTAAGGCACGCCTAGTGCCGCCGTCATGTTGCA
GCCAGTAATGATCGGGCCTATTTCCGTTGGACCGAACTTGGAGATGTACGTGCGGACAGTCGTGAAGCCGTGACTCTTGATGGTGGCCATATCGGCAGCA
ACGCTAGCAGCATCCATAGTGCCGCTGGCAGCGTGATTCGGGTCGTAGCACACACCATTGGCAGTCACTTGAGTCGAGAGCAACGCAACACCAATGGACA
GCGGGGCGAAGAATTTCATCGTGGTGAATTCGGAATTCTGGTGGATGGTTGTGCAAGTGATCGCAAATGAAGAAGTGAGCTTGGACTAGTTTGCTCTGTA
TGGGGCGGACTTGATTCGGATGGCATGGAGCACGGCAGGAAGTATCCGGTGGCGTGCCCATGTAACAGCCCCAGTTCGCGCGGCTTTCCGTCGGACAGGC
TTGGCGTCGTGCCAGAATCGTGCCGGCGCTGACTGAAACTGCCTTCAATGCATTCGTCTAGTCGGCACGCTGCTATCACGATGGCGAAGTTGAACGTCGA
AACTATGACTGTCATACGAATCTGCTAGATACTCCAGCACGATTGTTACTACTCCGTTTAAACTCTTCTATTTCGAAGCGGTTGTCAGCTCCCTTATAAA
CACGTGTACGTCGTGATGTAAAAAGTTAGTAGACATAATGTTGAATTATTTTACTCGAAAAAGAGTCAATCAATGACCCGCTTCCCTTGTTCGTTTGTTC
AGCTAACTGGCCGATGCAGTCATCCCCATACGGAAGAACCGGttcgcagcagcattcagcGGCGCAGGAGCTGTCGAGACCGGCACAGGCGGATGGAACT
GCTCAATGTCTTCGCAAAGTAGATCAATGAGCGCATCCTTGGTCAGCTTCTCGTCAGGTAGGTCGAAAGAGAAGTCGAAAGGCTGGGAACGCACGAGGTC
ATTCTCGTCGAAGAACGTAGCCAAATATGGGTGGCGCAACGCGGCGTCCACCGAGATACGCTTCTCCGGATTGAAAAGCAGCATTTTGTTCAACAGGTCA
ATAGCCTCCGCGCTTACTGCAACTGCGGCACCGCTTCCGGCAAACACGTCGAGCCACTTCTTTGGCTTCGAAATTGCTAACTTCGTGAGGAAGCGCAGCG
CCTTGGTGTTCTTCACAAAGTCGATATCCTCCTGCTTCGGCGTACCCAGAAACTTGATGATGAGCTTCAGTTGGTGTAAATAATCATTTCCAGGAAACAA
TGGCTCGCGCAGTAGCATTTCCGCAAAAATACAACCCACCGCCCACACGTCGATGGCTGCCGTGTAGTGCAGGCAGTTCAGCATGATCTCTGGAGCACGA
TACCAGCGTGTAACTACGTACTCGGTCAATTCACCTGGTTGTAGAGATTCTCGCCGCACACCGCCAATAGTTGATGACAGATTAACACCGCCACGAGCTA
GTCCAAAGTCGCAGACCTTGAGATCACAGTTTGCATTGAGCAGAATATTACTGGGCTTCATGTCACGGTGCAGCACGCCCGCCGagtggatgtggtgcag
tgCACAGAGCATCTGATACAAAAAGTACTTGACGTGGTCGTCCGACATGGGCTGCATTGAGTAGATGACCTGGTGCAGGTCAGTCTCCATGAGGTCTGTG
ATGATGTACATGTCGTTAAATTGCTTGCGAGAGGGAGGAGGCACCAAATCCATCAAATGcgtgatgttcttgtggTTGAAGTGATGCAGTAGCCGAACTT
CGCGCAAGATGCGCTTCGCATCCACAAGGTCTTCAAAGATGTTTGTAATTTTCTTGACTGCCAAGTTTTCGCCGTCGCTGATCACATCCTTGACCGCGAT
CACGGCGCCGTATGCCCCGTTGCCAATAGACTTCACCAGCTGATAACGCACATCAAGCGTGAACATTTGTCCGTTCGCGTTGAACGAGTGAGTCGGTGGT
TGTGACTGCATCAACGGAAAAAatccggagctgctgcttgtagCACCAAAGGCGGCGCGAGGATGCCGTGTGAGTGATGATCTCCCATCCCTAGCCTTGT
TGCAGTCTGTTTCCTGGTAGGGATTGATACCTCTAGATACTGAAGTAGCGTCCTTATAAGGTGCTACGGCACTTTGCGTTCCAAGGTTGTTCACACCACA
GTCTTCTGCAGATGACTCATCCTCGCTCGGACTATCCTCCTGGTtgtttcctccagtttcttccTCAGTGTCCACATTGTTGTCCAAGCCCGGCTCAGTG
CACACAGATGATTCACTTGAGCGGACGTCAGGGGTGCAACAATATCCGTTTGCACTGTATGCcgcgtcctcttcctctgttAACACCGGTTCCACTACTG
ACGCGTACTCCTGGCTGTGCAATTGGGTATCTGCAGCACGTAAGAcctgcatctgcatctcctcGAACGTCAGCTTGACTTCATCCAGCTCGTCATCTGT
GCTGTCTTGTCTGGCCATGCGAATCTCTTCAGCTGGGATCTCCGACTCGTAATGATTGTTATTGCTACATTCACTGCTCTCACTACTGCTGTTGCGTCCC
CGCGTCGTGTAAACACTCGACCGTCGTCCTTCACCCCCGTGCATGGGGGCGATTTTGGCTGCTCCAGCTACTGCACCCCACATTGCACCAGTGTcctcga
gtcgctgctgggTCTCTGCCTGTACAGTCAGTTTAGCAATACACGACGTCAGAACGTCCAGCCAACGGGCGTGCATCCGGTTGTccgctgctgccactct
CAGTGTCTTGATGTCCCCTGTTTCTGTGTGTTGCTCCACCCtaaactgcagctccagcacgtgTTTAATCTGTTGATAACACCGCAGATCTGTGACTGTA
TCGTACTGCGAGAGCACCACAACTGCGACTGAGCGTCCAGGCTTGTTCTCTGTCAGTGTAAACTGCTTCAAAGTGAAACGTAACCTTGTCCCCAGAGTAT
CCTGTTCTAGTTCCTCTTCCAGTACAAAATAACCTTTTTTACAGCGCCACGAgcgctgctccagctccgtcaaTAGCCCTTCAATGAGGATAGTTCCGTT
GGTTCCAGGAGGGGTCACACCGGCTgcgtgtctgctgctgcgctggagaCTGAGGGACCGCAAGAGCGCCCGTACAGGCGAGTCCGAGTGTGtcttggtc
tcttcttcctctccgtAGAGAGCGCGGTCGCTCAGAGGTCTGGGAGCAGCTGGCGAGTGTTCTTTACGTCGAAAGATCCTAGCCAAAAGTCTGTGGGTCT
GGGAGCGAGGTCCGTGGCTTGGAGAGGGAGACGCTAGAGGGGAAATAACGTGAGACAGTGAAGAAACCAGAGCTGAAGGTGCGGAGGAAGGAGAGCTCAT
AGTAGACTGCCGCGTCATGTAGAAGGAAAGGTAGAGCGCAGATGGCAACTGTTCAAGATTTCTAGTGAAGAGACGCTGGATAAAGAAATACCGAAACCGA
TTCTGACCTGGAAATAAACAGTTGGTGTGGTCTACACAAATCATACTGCATACTGAAAACATGTTACTTAACATGATTCTACCTTGTTCTACCTTGTTCT
ACCTTTTATTCCTTCAAAAATGGATAGTCTGTGTAGCCTCGAGCATCACCCAAATAAAATGTATCAACATCGAAGTCGTTCATGGGTTTGTTGAGCTCAA
AACGACGCACCAAATCCGGGTTCGAGATAAAGTGGCGGCCAATTGCAACTGCATTGGCCGCACCTTCATCGACAATCCGGACGGCCGCTTCGCGGTCAAA
ACCTGAGGCAGCAATCAGCACACCCTTGTATGTGTCTCGGAACTGCCGAGCGGACCCCTTCTCCGGCGCCAGAGGGTTACGAACATGGTACCCGCGAGGT
TCAATGAGGTGTGCGTAAGCCAGGTCGTACTTGTTCAACTTTTCCAGCACGTACGTGTACGTTGCAATGGGGTCTGAGTCCTTGTCGCCAAAGCTGCCAC
CGAACGGAGACAATCGAATACCAACCTTGGCAGAGTCAAGACTCTCGAGAATCACCTCCAGTGCCTCAAACAGGAACCGTGCGCGGTTCTGCACACTGCC
ACCGTACATGTCCGTGCGGTCGTTGATCCCGTCGTGCAGGAACTGCTCAAGCAGGTACCCATTGGCAGCGTGCAACTCGACGCCATCGAAGCCTGCCTTC
ACAGCGTTTTCAGCTGCCTGCCGGTAGTCCGCCAAAATACTAGGGATCTCGCTCGCTTCGAGTGCACGCGGCGGCACGGGCTCCATGCGTCCTTCGCGCG
TCGCAATCTTCTTGCCAGCCTTCatgttctccatcttggagCTTGAAGACACCGGCAAAATACCGTCTGGCTGGTTGAGTGGGTGACTGATACGTCCCGt
gtgccacagctgcagaaaCATCTTGGCACCCTTGTCGTGAACCGCCTGAGTGACGCTGCGCCACGCCTCGATTTGCTCAGTAGCGAAAATGCCAGGAGAG
CCCCAAGACCCACGAGCTGTGGGCGTAATGTTGGTAGCCTCAGCAATGATGAGACCGCCGGGAGTTGCACGCTGTTTGTAGTACTCAGCGCCCAGAGGCG
TCTGCACGCCCTGTTCACCAGTGCGCAACCGTGTGAGCGGTGCCATTACCAcgcggtgcagcagctgcacggGTTCCTTCTTGCCGCCTAGCGTCAGAGG
AGTGAAGAGCTTAGAAGTCATTGCTGGAAGAGAGAGTGGTGTGCGTCTTGCAAGGTCAATCGAGAAGTGAGACCGAGGTTCGGTACCTCATTGGTGAACT
CACTGTCATGAAGCTTGCGTCATCCGGAAGATGACGTGGACATAGACTAGTATGCGGATGGCAGGGGAGGTAATGGCATCTCATCAAATCTCCTTCACGA
ACTCCCGAGCTCTCGGCTAGCAGTGCATGTATAAAATAGTAGTGTTATGCAGTACAACATGCTCTTGCTagtgcacgagcagctcacAGACGAGATGATG
TAGATCCTGACTCAGGGTTCCTGAGGTAGTTGCTGGTCTCAGGCCACGATGTCGATTGCTACGACCGAAGAACCACCACGATCTACAACCTCCCTGGTGT
TGCTTCAGTCCGTCTGGAATCATCGATTGCTTCGTCCCCATCAGAAGTATCGCCATCCTAGTGTACATTAGCGCTTGGGCCATGCTGATACTCAGTGTAG
CTATATAAAGTGATCTCTGGGGGCATGTTGGCTTCTCTGCTGAACGCTTCCCTTCTGTTCCATGTTAAATTCGTGCTTAAAAAAAAGGTAGCATTGCCAT
GCTCTTAGATGTTAAGTACAAAGTAAAATGGTTATCTCCACTTCATGCGTACCTTCATGTGCATCGACACTGGCGACGACTGTAGTTCTCCGTTCGTTCC
AACGTCCTAGTGGGTAAGTGGTAGCTACAGCCTTCGCTCTGTGTCTATTTGTCTATGTTCCTCTCCTTTCGATCCTTTCGCCTCCCATGAACCGACTGGT
AGAAGCATTTTCGAGCCTGAGCATTTGCTCTCCCCGAGTCCGTCCCTCATAATCAGAATCCTCCAATCTCTCGTCTGATTGGTTTATAATTCTACAATCT
CTCTCCCGATTGGTTTATAATCTTTCGATCTCACATTTTTTAATCATTCCACATCATTCACAGGAAGCCGCAAGTCGCCAGTTATGGGCCAGCGCCTCAG
CACTACGCGCGACAGCGACTTGGAGAAAGAAGCCCCCCCCTCTTCCTATCTACCTCCTCTCGCGCCTGACGTATCCTCAACTTCCAACTCCCCAGACAAA
CCAAGTTCTCCACCGCCAGCCACAGATCCAGATCTCATCTCCACTTTATCGACCCAACGTCCTGCAATTGAAAGCCAAGAGATTAATCCTGACCAGAGGA
GGGATGATACCCCCCAAAATCTCAGTCGCAGGAGTTCAATGAAGCTGGGTGATGTTATTCGAGCCTCCGTTTCAAGCACTCACGACCAGGAACCTTCAGT
GCATCAACAACAgaacgaagacgacgctcaTCCCCTTACTATACCGCGAGACTCCTCAACGGACTCATTCCCTTCCTCCCCAAGTAACTTACTGCCTGAT
GATGGTCATCCACTACGTCGCAGCTCCATGTCCCGCTCTCCAGCCCCAAAACTCTCGCGGTTCCGGCCGACGATGGATCTGGACATGGGGAAGGCCCCTA
ATTCCCCACAATCTGGCTATTTGTCCAGTTCAGACTCGCGCTCTTTGGattccagctccagttcttcagatgaagagctgattgGCAGTGGAGAGGAGAT
GGCAGTGAGTGACTGGCTGGACGAGCCGGAGGATGCAATTTTGTCTCCTCTGGCGGGGCCTAAACGCGCTCGTCATGCTAGCGGCTGCTCCTCAGTGTCA
TCGGTATCTCATGCTCCAAGTACATCGTTCAACGGCATGCACAGCAGTGGGGGTCgcaacagtagcagtagtCAGCACAGCATGTCGGCGTGGCCTTCGT
GGCTCAGTTCACCGGACGAtatcgaggaagaggacgatgctgacgacgaaCCTGTGGCACTCACACCATTTTTGAGAGATAATATGCCAGTATACGAAAT
CATGAGGCAGGTGCAGCTGTTCCGGAACCTAAGTCAAATGCAACAAGAGCATGTGGTGCGAGCGCTGAAGCCTGCTAAGTTTTCAGACGGAGAGGTCATT
GTGGCGCAAGGTATGCGAGGTAATCGATTTTACATGATTGCTAAGGGAGAGGCAGTTGTCACCAAGACTGTCGTTGCCAGTAGCAATAGCATTACTGGAT
CAACTCCCTCGAATGCAGGGCGGACTCAAGAGCGCATGATTACGCACCTGCGAGCTGGTCACTACTTTGGTGAGCTAGCACTAATCTACGATGATCCACG
CACAGCTACGGTGCGTGCTGTTGGTGACGTCGAACTGCTATACTTGACGCAAGAAGACTTCCAGCATATTGGCCAGGTGCACTTGAGTCTCATGCTGCAA
CAGGTGCCACTGTTGGCAAGATTGAGCGCTCAGGATCAGGATATTGTACTTAAGTGCTTGCGGCCTTCCAACTTCAATGATGGCGAGTACATTGTGCATC
AAGGAGACGAAGGCACGCGGTTCTACATGATCACGCGTGGTGAGGCCATTGTGTCGGAGAAGGCTGTGGGTCCGAACAAAAAGCCATACGAAAAGGAACT
AACGCGGTTGTACGAGGGTCACGTGTTTGGCGAGATGTCGCTCATCTACAGCGAACCTCGCACAGCGTCAGTGCGTGCAGTTGGTCCTGTTAAGTGTCTT
TATCTGAGCAAAGAGGACTTCGATAAATGCTTGTTGTCCGATCACTTCCAGCGTTTCATCCAAGAAGCATATGTGGAAAAAGCTACGCGGCGTGCCATGC
GACTACGGCTGCAACAGCGCGCTAGTAGTGCTGCTAGTTTGGCCTCCTCCACGCCACAGGCAAGTTCTGGGGCCGAGAGTTCGTCTGGATCCATTGTAgc
gccgccaccagctcctACGTCACCTGTGAAAGCCACGGAAaccaagaagctcgtgaAGCAACGCCTGAAGAACGGAGAGGTTGTGGTGAATAAATACGTG
ATCAAGGGCGACTTGGGTCGAGGAACATTCGGTCGCGTAAAACTTTGCGAAAGCCAAGAGGACCACCAAATGTACGCTGTGAAGATCATGCACAAGACTT
TTGTTCAGCGAATGGCTGGCAAGGAAGATCAGCTCTACGATGTGCTAAGGCGTGAGGTTgccatcatgaagaagttgaacCACCACAACGTTGTGAGGCT
CGTGGAGGTTATCGATGATCCTTCCAGTCAAAAAATGTACCTCGTGCAGGAATATGTGCAACACAGTCTAATGGAGGAGGTCACGCAGGCACGGCGACTT
GGTGAAGAGGTGACACGAAAGTACATGCGCGATCTTCTCAGCGGGTTGCAGTACCTACATTTCCACAAGGTCATTCATCGTGATATTAAGCCGGAAAATA
TTCTCGTAAGTTCCGATGGTGTAGCTAAGATTGCCGATTTCGGTACGGCTCGCATGATCATGAACGAGACGGAGACGATCTCTGGCGCTAAGGGGACCCC
GGCCTTTATGGCTCCAGAGATGTTCGACATTGATGCCAAGTACCAAGGTCCCGCCGTAGATGTGTGGTCACTCGGTGCTACGTTGTACATGATGGTAATT
GGGCATCCACCTTGGCTTGCAGACAACGAAATCGTGCTGGCAGAGCGTGTTCAGCGCGTGGAGCTGCGATTCCCTAAGGATGTAGAACGCACCATGGAGC
CGCATCTGAAAAACCTACTGCAGCGCATGCTTACGAAGGATCCTGGCTTGCGTATTACTCTGAAAGAGTGCTTTACCCATGAGTGGGTTACCAATGAAGG
CAGTGAGCCTCTTGGTTTGATCACAGCGGAGAAGGATCTTACGGTCTCAATGGATGAGAGCGAGCGGGCTATCGAAAACATTCCAGAGCGCATTGACCAG
CGACTGACGGAAAGTCTTGCCCAAGCTCATATGTTGGTGAAGACTCGCCAGGAAAGTGTGGGTCCGGGAGTGGTTCGTACGAACAGTGGGCGCTACTTTA
CGGGCACACCCGTGTCGGGGACCCTGGGTTCGCGCATCCCGTCGTCCGCATCGAACACGTCATCTGTTGCAACTGTTGGTAGTTCAGCATCCATGAGCCC
GAGTCGCGCATCCAGTGATGAAGTTTCACGCATCATCTGTGCTTGGCGTCACCACAAGCGCGTACAGCTCATGGATGGTCACAAGGAGCTCTCCGAACGC
TCACGCGAACTGCTGATAGAGCAGAAGCGCATGGCTTTCTCGGTGGACCGCGCAAAAGTGACTGAAATTATTCTACCGGCAGCTAAGCCTACATCTCGCA
GTCGCTATCCCAGTAATGCATCGGTTGCTTCGCTGCGCCAAGTGAGAGAGCAGTCGGTTCTGTCCTCGGCGTCATCGGTCTCATCACTATCGACAATAGG
TGGCGATACGCCTTCCGCTGGCTCACCGCGGTCGCAGTCGTTTTCTTCCGTACGAAGCAATTCTGTGGACAATTCgctgctgacgaagaagaacagTTTC
CAAGGGCGAATGGTGAAAGACTCTGGTAATCTTGAAGGCTTCGGGCGCACTTCATTCACGTCTGTTTCGCAGCTGTCCGAATTTGCGGTTTCTCTCGATG
ATAGTATGGATCAACGTGGCAGCTTATCTAGCGAGTCTGGGAGTGCCAGCTTCTTTGGCAGCAATATATCCAACACGGGATCATCAGATGCAGACCTGAT
GAAGCGATCGCTTTCACGTAAGAAAGATTTCCTCATGGTGACATCAGAGGTGTTCCgagatgaaggtggtgattACCAGACCCGTAAAATCCTCTTCCAA
GCGCGCGATGATGACTTTTCGGTGGCCTCACGTGTGCCGACGCACTCAAACTCAGGCCGTGAACTCCTTCCACCTGGTCGCGCTAGTTCGACCAACTCGT
CACAGAAGCCAAAAAGTGCTGGCAGTGCTAGCAGTGCGAGTGGAATGAGCAGCGCTTTAGGTAGTACTGGCCGTCAATCAATGAATGGGAGTGCCGGGTC
aatcagcagctcgtcaCGATCGGTTATTACAGACGATGGAAACGTAGAGGAGTTTGATATGGAAGGCATCGATTGCGTACAAGTAACAGAAatcgatgac
gaggacgatgatgatTTGGTGGGTCGCCCCGCCCACGGCACAAGTGGCTCCTCCTCGCGGCATTTCCGCCACCATGGGAGCGACACTAGTCGCGCGCGCA
GTAGCCACGACCAGAGCCTAACATCTCAAGGTTTGGGTGGACTTTCTGACGCTGATAGTGACTCGGACGATTCAGATTACTCGGATGTGGAAGGTGACGT
CGATGTGGACGCAACGTTCAGTGACCTTATTGCCACGCCCAACACATTGGATATTATCAGTcacgatgatgaggaaatCGCACCTGTAGTATCGTCAAAG
GCATCCATGTCATCCATGGCATCCATGGTAAACTCCCCGTTATCTTCGCTGGATGTGGACAACAGTGGTAATGTACTTACTCTGGGGTCACTGGCATCGA
TGGCTTCGGGTTCATCAGCGTTATCTATGGCAACCCCTGCACCAATGCTTGACATCGTGCAGGTGTATGTGAGCAGTAAAATTCGAGAGAACCTCTCACT
TGCAATCCGTTCAGGATATGCTGAAGCAAAGGGAGCCCGGTCATACATGGAAGACAGAACTACTGGCCAGACGACTTGTGATCTCTCAAGTTACCCGGAT
GTCCTCGCGAACACATACGTCTCGTTGGCATTCTTCGGTGTATACGATGGCCACAACGGCACTAGTACGGCTGTGAAATTGCAGCGAGAGCTGCATCACC
GATTCTTCGCCGAAGGTGCTGGTTTCGTGGAGTCTCCTGTGACGTGCATCTCGTCAGTGTGTGAGACGATCGATAACGAGATCCTGGAACAGCAGAACCG
TAGCGTCTTGCCTAAGCGTACACGCACCATGGCTCCAGGTGAAATGCAGCGCTACTTTGAAAATGAAGGTATCGATCCCAGCCTTGTAGAAAATGAGTGC
TGCGATGTCGATGGCAAGATTGTGTGCGGagaggagatgaaggcgcAGCTGCAGCCCATCTCATTCTCGGGAAGCGCTAGTGTATTTGCTGTGGTTGCCA
AacagcgcaagaaacgtCGGCGTACGAACGCTAATACCGAAGAGGACAATGCAGAAGAAACGAAGGAAATTAATACGAGCGAGAGTGAGGAAGAGAATAA
GGatggcgacgaagacgaggaggaagatcAGCCCACTCGGTTGTACGTAGCAAATGTGGGTGACTGCCGCGCAGTGTTGTGCACAGCGGATGGTGATGCG
GTGGACTTGACAATAGACCACAAAGCGTCTCTTTCTGCCGAGAAAGAACGGATCGAGGCTTCAGGAGGCTTCGTGCACAACGGGCGGCTGGATGGCATTC
TGGCAATCTCGCGTGGCTTCGGCGATCTGGCGCACAAGCAGGATGGACATTTGGTTGTGACACCTGATGTGATCGAGCACCTGGTGAACCCTGCTGACCA
GTTCATGCTACTTGCAAGTGATGGTCTGTTTGACGTTCTAACGTCGCAGCAGGCCGTGAACTTTGTGCTGCGTAAACTTCAGACTCATGGCGACGTGCAG
CttgcagcgcaagaacttGTGCTCAAAGCTCAGGCGTACTTCGCGCATGATAACATTAGTGTGGTCATCGTGGCACTCAATCAGAAGGGCGACAACTGAC
TCATTCACCGGCGTCATTCGCGATCGTACGCAAATGACCCACAGCCGACAAAAACGAGGAAAAAGGCTGAAAATTACCAACAACAGTGACTCGCTCGCCC
AGTTCGCAACAAGCGGGCATATGTGTGATGAAAAATTGTAAAACCAGAAAAACAAGACGAATATATTAGCGGTGCACCTTCACACGTTGATTCCAATTGC
GCGAAGTCTTCCAATGGACATAGCGCTTGGTGACGGTGGAGGGAGTCGTACTATGGCTACACCTTCATGCCTTATAATTATTACGTCACCCTCTACCTAC
TCCCCGCCCCGAGCTTATTGCAGATGCTTCCTCCCAGTTCTCCAGTTCGTCCCAAGAACGtagttcttcttgatctccCAGTACAAACACTGGTGAAGGC
AGGTCGATGACGGAACCTATTGATGACGTATGGCTGTTGTCATCCAGGTGGTATCCTAAAGTGTATTCTCCTTCCCCGTCCGTGTCAACATAGGCCCCAT
CCATCTCATC