Description :
From Genome Similarity Track
Location :
contig_39:485235- 486650
Transcript NameFunction/comments
g7003.t1hypothetical protein

Sequence
1415 bases(100 bases per row)
AACCAAAATGGGTCCTGTACACGAGCGTGCTACTTGGAGTCATGATTTCGATGCAGTACGGATGGTCGACGTCCCAGCTCAACTACTCCAAGTTCAACAA
GGAGAAAGACTGCAACGCTCGCCCCGTCGCCAATGGCACGTGCACCATGTTCCCTGGACACTCTAAGGCGGAGTGGACGGTCGTTGTCAATGCCTGGGTG
TTTGGTGGAATGATCGGGGCTCTCTTGGTCGGCAAGATTTCGGATCAAGTAGGACGCAAGCGAGCGCTGATGTACAACTGCGGCTTCATCATCGCTGGCG
CTACGATCCAGGCAGCGGTGTCCAACATTTGGGCGTTCGCGTTCGGTCGTCTCTTAGCTGGGATTGCGTCGGGAGCTAGCACCGGATGCGGGACCTACAT
CAACGAGATTGCGCCTCCTCACCTTCGCTCGAAGCTCGGCATCGGCCTTCAGGGTGGAATCAACCTCGGCATCGTGCTGGTCGACACCACGCACTTCTAC
CTGGGCTTTGACCAAGGCTGGCGGATTATCGCCGGCTTCCCCATCGTGTTAGGAACGCTGTTTTGGCTCTGTCCCATTTCGTCATGGTCGAGTCTCCAGT
GTGGCTGCTGCTCCACGGACACCGCAAGGAGGGCGAGCAGGTGCTCGTTCGGCTCTACGGTGAAGAGAACGTCAACACCGCACTGTCCTGGATCAAGCCG
GAGAAGAAAGCGGTGGATGTGGAGAAGCAGACCCCGTGCTGGAGTGAGGTTGGTCACGAGACTGTGATCAAGGGCAAAGGTCTCACCTGGGGCGAGCTGT
TTGCAGTCGAGATGCGCAGACCGCTGGTGGTCGGCATGGGGCTCGCGTGCATGCAGAAGCTCACGGGTATCAACTCCATCTTCTACTACTCGTCCAGCCT
GTTCGGCGGCGTTGGTGTCGCGGACGGCCGTGTCTGCAACATCATCGTGGCTATCGTCAACCTCATCCCGACGCTGTGCTCGGGTATGATCTCGGCCAAG
TTCGGCAACCGCCCGATGATCCTCTTCAGTACGGTCGGCATGTGCGTCAGTGCCGTCGGGATCACGCTGTCCCTCGCGTTCGACGCTCCGCAAGCGACGG
TCGCTCTTGCTGCTGCCTTCGTCTTCTCGTTCGCTATCTGCCTCGGCCCAATCATGTTCGTGGTCGTCGCTGCCGTCGTCCCGGATCACGCTCGCGGCTC
GGTCGTGTCCATTGGCATTTTCGTTGCCTGGGCCGCCAACCTGCTCGTCGGCATCGGCTACCCTTACATGGCCACGGCGCTGGACACGTACAAGTATGTC
CCGTTCGCGGTCATCTCCGCACTCTCGACCGTCTTCGTGTACTACCTGGTCCCGGAGACGTCGAACTTGACGACTGCCGAGATCCAGGACGTGTTCAAGA
AGATCCGCGGCAATG