Description :
From Genome Similarity Track
Location :
Scaffold_308:4852- 8111
Sequence
3259 bases(100 bases per row)
AGTGGCTATGGAGGCCGTCCGGGCGAATGGACAGACGCAGTTGTGCGACGAAGAAATGCTCTCGGACCTGGAGTTGCTACTGTAGCTGGGTTGGTGGTGC
TACGCTCGGTGCCATGCTTGGTGCTGGCTGGAGGTGGTGATGAATTTTTACTGGGCCGCAAGGTGCTCAAGGGACTCGGCATTGACGTGGAACAGCAATT
TTCCCAGCTGGCTGGCTCCCCACTTCTCGAGGATGAGGTGGGCGAGTTTCCGGTGGGAGATGAACTCCCGCCACCTGTAGATGTAGTCGAGCCAATACGT
TTACTGGACGAACAGCTAGAACGTGCCGTCACCAGTGGACTCCCCGCTAAACACGTCGAGGCCGTCCGTGACCTGCTTGCTGCATTTCTTGATATTTGGC
GTGACGCTGTCGGTCCCGATCCACCGGCTGACGTCGAGCCACTCCATGTGACGCTGCGGCAAGATGCAGTGCCTTACCGCACCCATCCACGGAAGAACGC
ACCGCTACAAGCCCAATTCATCCGCGAATATGTGAAGTCTCTCGTTGCGAATAATCTGGTGGAGCCAAACAACGCCGCCCGATTGCCTGCGCGGCGGTGC
CAGTGCGCAAGCCAGGCACGAAGGATCAATTTCGTCTCACTATCGACTACAGGCCTGTAAACAGCGTCACTGTCCCGATAGCAGGTAGTATGCCCACCGC
TGCGTCTCTGCTCGATGCATTGGAGAGCTTCCGGAATAAGAAGGTGTTTGGCCGAGTGGACTTTTCGCAAGGTTTTTAGCAGATACCTCTGCACGAAGAG
AGCAGGAAATTTTCTCGTTTATTACTCCTGATGGTGTCTTCGCACCCACCCGAGAGCCCCAAGGAGCTATGGACTCCGCTCTGTTACAGAGCCAAGTGCA
AGCAAAATTAGCCCCTCTGATACCGCACTCGGCGATCGTCTGGGTCGACGACGTGCTGCTCTTTGCGCCGACAATAAAGGAATTCTTGCAAACGCTCTGC
ACATTTTTTGAGATCGTGCACGACGCTGGTTTCAAGCTCAACATGTCGAAGTCATCGCTGTTCGCGGTGGAAATATTGTGGTGCGGTCGTCTGATTTCGG
GTGAGGGCGTCCGTCACGACCCCGCCCGTGTCGATGCTCTTGCCAACTTGCCATTGCCTGCTACAGTGGTGGAGCTGCAATATTTTGTCTGCGCTACTAA
TTGGTTGCACGATTCTTTCTATGACTACGCGCGTGTAATTGCCCCGCTACAAGGCAAATTGAATGCGGAATGTAGTCGGATTGGAAAGCGCAACCGGAAT
GCTGTAAATATTGCTACAACGTGGTCTAACGAGGAACGAGCTGCGTACAACGCGGTCGTTGCCTTAGTGGCGAATTCTGCTCTCATGACTTTCCCGGATG
TTAACGCCGAACTACTACTTTTCACGGATGCCTCTGCCACTGGATATTGCATAATTGTTGCTCAAGTTCGTGATTAGAATTTCTCGTTGCCGGTGGATCA
ACAGCACCATGAACTCGTAGTGTGCAAAGGTGGCACTTTCAAGCACTCCAAGCTCAATTGGGCGGTCGTGGAAAAAGAGGCTTTTTCGATCGTCAAAGCC
TGCCAGGATCTCGAATACCTCCTACTCCGGCCGAAAGGGTTTCGCTTATTCTGCGACCATGCCAACTTGGCGTACATTTCTGCCCCAGACGTTGAACTAA
AAAAAACATGTTGGTCATCGGTTGCAGCGTTGGGCGATGTGTCTCTGTGGCATCCACTATACGATCGAGCACATTCCAGGGGAGAAGAATGTATGGGCCG
ACATCATCTCCCGCTGGCACACGCGTGACTCTGTGCAGGTCGCAGCCGTGCAGACGCGCAGCGGTCAAATTGCCCCAGTGTCCTCACTCTCGCCTCTCCA
CCCTCTCGCGGACGAAAACTTTGCGTTCCCATCTCGTGAAGACATAAAGGCTGCTCAAGCCGCCGCTGCACGCGAGCGTTCTAGGTTGACCAGTTTCTCG
GAGGAGGAGGATGGTGTGGTGACCATCAACCACCGCATCTGGATACCCGCTGCTGCACAGGACTTGCTCGCTCGACTGTTTGTGGTTGCCCACTGTTGAT
CTTAAGGTCATCGTGGTCAAGCACCGATGATTTTGGCGCTGAAGGATCGATTTCAGATTGCACGACTGGAGACCAAAGTGGCCAAATTCGTTCGCGAGTG
CCTACTGTGGAGCATTTTAAAGGACCTCGTCAAATACCCCGTCCGTATGGTCCGTTGCTGACTCCTGTCCGGAGAATCGAGGTCGTCCATTGGGACGTTT
TGACTCTTGGTGAAGGTTTTGGCGATTCGTCGTACTTACTGGTAGTGAAGGATGGGCTATCCCATTTTTGTGAGCTTTTCCCGTGTACTACCCCGACCGC
ATACACCGCTGCTGAGGCGGTGACGATGTGGCATGCCAGGTATGACCTCCCGAGAGACACTGATCTCCGACCAAGGAATGCATTTTCGCAATACGATGAA
GAAGCACCTGGCTGCGAGACTGAATGTGGAGCTAAGATCTACCCCGGTCTACTCCCCATGGCTAAATGACACGGTTGAGAGGCTGAACAAGGACGTGTTA
CAAGTCTTTAAAGCCCTGTTGATGGAGTATGCACTGGACGCGAGCGAATGGCCGTATTTTTCTGCCTGCGGTGCAGGCAAACCTCAATCACACGCGCGTG
CAATCGCATGCTGGATGTGCCCCCATGGAAGTGTTTACGGGACTTCCCGCGTCGTCATCTCTTGACGCAATCGTAGTGCCAACAACACCTGAGAGAAGTG
AACGTATCGCCAACCTGGACAACGTGGCGGAATTCGTTGACCAGCTCCGTGTGTCGCTCCGTGCTCTCCACAAGGAAGTGGCTGACGCTCGCCAGCGACA
ACGGCTTCGTGATATCGCTGCGCACCGTGGTACTGCTGCGCACCGTGATACCGCTGCAATTTTGACGTCGGTGACTTTGTGCTGTGGTCGAGGATCGACA
AGCGCCTGCCCAACCACAAGCTCTTGGGGCATTGGGTTGGGCCGTTCAAGGTCGTCGCTGCGCTGCCGCACTCGTTTGAAATCCAGCACTTGGTGACAGG
GCGCAAGTACGACGTCCATGCTTCCCGTTTGAAGTTTTACTCGGATGCAGAACTGGATACAGCTGCAGAGCTGCTGGAGCTGGTGTCAAGCCAAGGTATG
CTTCTTGGTGTTGACAGGTTCGTCGATCATCGCATCAACGCTGCACTGGAGCGCTGGGA