Description :
From Genome Similarity Track
Location :
scaffold_10:485088- 486635
Transcript NameFunction/comments
Plaha_PHALS_11627hect e3 ubiquitin

Sequence
1547 bases(100 bases per row)
GCGCCTCAGCTTCACCTAACGCGACAGCACCACGCTGTACTTCTTCATCCGATGTCAGAATTCCACTGGTTAAATACGTCGGTGGGATGATCGGAAGTTC
TGCTTCATCCGAAAcaaaatcttcatcaattgCCATCGAATCTTGCTCCGACTGTTTAAGACCAAACGCCCAATGGACTAACGAGAAAGTCACTAATTCT
GACAAAATTATCGCGACAACTTCGACAAGTGCTCGATCAATCGAGCACATGGATGTTAGCTCGACAACGTTTCCGACTACAATTGCGCGTTGCTGCCATG
GCATCGCTGTCATGTCATGGTTTCCACAAAAATGTTGTAATATAGACGCCCAAAATAACCCTACTGTCTTTGTTTTGTCAGCTGATGTAGTAGTCACATA
GCTCAGTATTGGAGAGGTTGCTGCAGAAGGCGAAAGTAGCATTCTGTTTGCAAATGTTTGATACACCTTGGACCGTCGCATCTGCTGATCTTGATTCGAT
AATTGTAGCGCTTGAGCGGCAATTTTTGCAATAATTTGAGTCAATTGATCACTTTCTAAACGAGATACACCTTCTCTCTCCTGTTCGGCAATGCACGCTC
TCAAGGCATCAAATATCCCGTATCTTGGGGTAATACTTATATGATGCAATACATTCGAGAGTGCTTTCTGTCCTTCAAATGTCGAATAATTGGAAAAATT
TGTCAATGTTTCTATGAGTAACACGTACGGATGTGAAGCAATCGCTGGATTCGCTACCGAAGTTTTAAGTTCCTCTTGTACTAATGTCTGTAAAGAAATC
TCACACATTCTTGCGGCTTGATACACCCAGCACGCATCCTTCTCCACTTCAAAAAATGATGTTCCCCGTTCGCCCTTCAAACAATTAACAAGTAACATAA
ACACCAAATAGTCCTGTACTTTGCGTAATCTGTCAACGGCCACATGATTTTTTGATATCGCTGGCCTTGCAAAGAGAAATTGCTTGAGGAAATGCTGCAG
CTGCACCGTAGGCAAAGCCTGATTCTGGATATCACCAGTCAAAACAGTGTGGGTGAGCTCTTGCTCCAACAAGCTAAATACTTCAGACCTCGCTTGGGTT
GCGGCTTTCAGACGGCGGTACTGGGCCTGAATTCGAATGCCAGCGGCCACACGCGCTTTTGTAGCGTGGCGCTCTTCCCTAGCCAAGCGGTTTTGCAACA
TAAGCTCTTCCTTGGAACCAGCAAGCACATCTCCATTTTTTGAACTTGAAAGTGAGGCAATGTGCGCACTATAACCCGTCGTGGGCTTCTTGCGGCCGCT
AAGGTTGACCTTGCGCGCGGGCTTAAAGCTACCGTCAAACATGGGCGATTACTATGTCAATGCGATAGTATTGAAGAAGATTCAGCACGAAGAGTGCGGA
ACCGTTAAATGGCTAAAATTAAGCGATGCGGTGACGATTCTGCTCGATCCTTCGCGTAAAGTTAGAGTGAAGAGAGCGCTACGTGATTAATTCTATCTAA
TCATTTCTACCAATCCTTGCGCGGTATTATGTAAAATGATGACAACT