Description :
From Genome Similarity Track
Location :
Scaffold_344:485- 2172
Sequence
1687 bases(100 bases per row)
AGCAAACGGCACAGCGGAGCGGATGGTCCAGACTATTTCCAGATCTCTGCGGATGTACGTTGAAGACGAGAACCAACAGGACTGGGATGAATATGCGGAG
CGGTTGGTGTTTACGTTGAACACATCGCACGACCGAGTACGCAAGGACACGCCATTCTTTTTGCTGCACGGGTGGGACCCTAAAACGACTATTGAGGCAT
CGTTGGCTGTTGGAGGGACCGGAAGCCGAGATCTCGACCCACAGAAATGGAGGTTCAAGATCCAACGCCAATACCAACGTGCTTAGACAGAGACTCGTCG
TCTCCTCGCCAAAGCTCGTGAGAGTCGCGCGGAAGCCCACAATGAGAACGTACCGGAGTCACCCATTGAGGAGGGATCGCAGGTGTGGCTGTACCTCGAC
CGAATCAAGGTCGGATACGCTCGGAAGCTCGCTCACATGTGGCATGGGCCTTTCAGAGTCGCCACCATGGTGAGCGACTACGCTGCCAAGCTGGAAATCA
GCGGGACTGACTACATACTGTTCCCTATCGTACACATCTCGAAGCTGAAGCTGGTCCGACAGTTCCCCGCGTAACCCGCCGAAGATCTCACTGTTGATGA
AAGCGAACGATTTGACTTTGACGAAGAACTTCTCCCGGACGATAGCTGGGAGGCACAAACTCGCGGTGACAACGAGTATGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN