Description :
From Genome Similarity Track
Location :
scaffold_63:48493- 51027
Transcript NameFunction/comments
g2508.t1 oligopeptidase A, putative

Sequence
2534 bases(100 bases per row)
CCGTACTGCATGAGCAGCGGCACCATGGAGTGCTTGCGACCGCGGAAGGCCTCGAACACCTGCTCCGGGTGCTGGCCGCCGCCGCGCGCCAGAATCGTGT
CGCGGAACTTGCGACCGACGCGCGCCTCAGCCTCGGGGCTCTCCTTAGCAGCCTCCTCGAAGGCGCCGTACGCATCACACGACAGGATCTCCGCCCACTT
GTAGCTGCAGATAAACAAGTACAAGAGTTAGTTGTGCGTTCGTTCACTGTTGACACGTTGCACTTGTCAGCCGACGTACCTGTAATAACCCGCAGCATAG
CCGCCAGCGAAGATGTGTGCAAACGAACACAGGAACCTGTCCTCCTTCAGTGGATTCAGCACCGCGTATTTGCCCAGCAGACGCTGCTGCACCTCGAACA
ACGATTCCTGCGACGGCGAGTAGTGCGAGTGCAGGTACATGTCTAACGCGCCGAATCCCAATTGGCGCAGCATGACTGTGGCCACCATGTAGTTACGCGC
CGCCTTGAGTTTCTCGAAGAGCTCATCCGGCAGCTGCTTACCCGTCTTGAAGTGTCCGCTGATAGCTGCGATCGTGTCTGTGAAGTCCATACAGCAACAA
GGTGAGCAGTCATTGATACTATCAATTCGTGTATATACCAACCTTTGTCGTAGCAGAAGTTCTCCATCATTTGCGACGGGATCTCGACAGCGTCCCATTC
GATGCCGTTAATACCCGCCACGTCACCGTACTCCATCTGCGTCAGCATGTGCTGCAGTCCATGACCGAACTCGTGGAAGATCGTCTCCACCTCACGGAAC
GTCATGAGGCTTGGAGTTTCACCCACCGGCGGCGACTGGTTGCAGATGATGTAGGCCACGGGAACGCGCTTGCCTCCTTGCTCCTCAGGGCCAAGTAGGC
GGCTGCGGTCCACGCAGGTGTTCATCCAAGCACCACCGTTCTTTTCCTTCGGGCGCGAGTAGGGATCCAGGAAAAAACGAGCGATCACCTCCTTGTCACC
TTCAGTGCTGCGGACGTTGAAAAAGCGAACATCCGAGTTCCAGACCTCGGCCTGGCCGTCCGCGGCCTCGATTTCCACGCCAAATAACCGCGACGTCAGC
GAGAACAGACCATCCAATACCTACACGTAAGCAATGTTAGCAGCATGTAAGGCACCTCAAGCGAATACACATTAATATCTACAGCAAACAATAACGTACG
CGCTCAAGCGGGAAGTAGGGCTTGATCTCTTCATCAGTGAACAAGTATTTCTCCGCCTTCAGCTTTTCAGACCTGCTCTCAGAATGCACGGATAACATAG
ATCAGTAACTACACAATGAGATGATGCGAGTGTTGTAGCTTCGTACCAGTAACCAAGATCCCATGGCGCCAGGGGCTCCGTCTGTCCGTGCTGCTTCGCG
TACTCAGCAACGGTATTCACCTCTTCGTGGGCGATGGCAATGCACTTTTCACGCAGATCGCTGTGCATCCTCTCCACTTCTTCCACACTCGGCGCCATCT
TCTTGGATATACTCACTTCCGCAAACGAGTTGAAGCCAAGCAGCTGGGCAAGCTGCTTGCGGATCTCGAGCAATTCGTTGACAATAACTTCGTTGTCGAA
AGACTCACCACTCGCACGGGTCGCATACGCGCGATACAGATTTTCACGCAGAGACCTGTTTGCCGAGTACTTCATGAACTGCACATACGACGGCGGGTCC
AGCGTCACACGCCACGGTCCATTCTCAGGAGAGGCATCCGAGTGGCCCTCGTCACGGGCGCTCTGCGCGAACATCTGCAGCAACGAAGGAGGGAGGCCTT
CCAACTCATTTTTATCACTGATTGTGATCGAGTACGCCTTGGTAGCGTCCAGCAAGTTCGACGAGAACTTGGTGCTCTGTAGTCAGCAACCAAAAGTAAG
AATCCGGTCCAGAATCACAATAGAAAAACAACTTCCCCAGTCTTACCAACTCAGCAGAGCGCAGCTTGAGCTTGTTGAATTTTTCCTTCTCTTCTCCTTC
CAGCCCCACGCCACTGAGCGTAGCACTGCGCAGACTGAGCTCGATGATGCGCTGCTGCGCCAGCTCGAGTTTGCTCCACTCGTCACTCTCGCGGATCGCA
AGATACGCGTCGTAGAGCGTTTTGCTCTGCGAAGCTTCGGTGACTGTCTGGATCACCAGCTGCTGCAGCTTGTCGTGCACAGCGCGTAGTTCCTCCGAGT
TGCGCACGCTCATAAGGTGGCCCACGATGCCCCACATGCGTCCCAGCGCGTCTCCCTGCACCTCCAGCGGATCTACCACGTTCTCGAACTGCACATTCTT
ACCGACGTCGCGCAGCTTCTTCTCTAGCTCGTGCAGGTCGCGCGTGTAGTTGGCAGCGGCGTTGGTGACCGCCGGCTCAATCTCGTCCAGCTGGAGACGC
TCGAAGGGTGGCAGGTGGCGCTCACGCACGCACGCCTCCAACGAATTGGCAGACGCAGATGCAAAGCTGCGCCAAAACAGCGCCGATCGGCGGGAGGCGG
CGCCGGCAGACGTCGCGCGAAGGGGGCGCACACA