Description :
From Genome Similarity Track
Location :
Scaffold_1645:4849- 6274
Sequence
1425 bases(100 bases per row)
TCGCAAGTAATCAAACAACAGGCCTCCACAGGAGAGATTTGCTAGCGGTTCCCAAGTTTATTCGTCATAGCCAATCCACTTGACCTTGAATAATCTCCGG
GTCCGATAAGTGCTCGTCGAAAGTGGTATCTTATCATCCAATATAGCTTCAGCTTCATATTTGCCTGCATCCTCGCTGACTTCCCAGCTGTCTTCAGGAA
GCAATTCTTCGTCAAAGCCAAAGCGTTGAGCTTCACTCAGCTCGTCCGCTAACCTCGCTGTTGGTCTCGTTTCCGGGTCAGCTACTGCTTTCAGCCGAGA
CACGTGCACCACAGGATAGAACGGTAACCACTCTTGTCAGGCAACACGAGCTCATACGCAAATTCTTCAACCTTCATCTTCACCCGGAATGGACCATGCC
ATCGGTGGGccagtttcttcttcaagtcAGGTTTCACCCGCTCCATGAACAGCCACACTTGGTCTCCTGCCTTGATCAACGATTGTTGCGGTCCAGCTGA
CTCGGCTGTAGCctcatcttcgtctccagctgAGTCTATTGCATCTTCCGCTGAGTTCTCTGTGTCTtccgccgagttcctggcgCTTGAAATAACTCTT
CGTTCCCTCTTGCTGACCTTAGCGTTACGTTCTTTCGCCCGCCGAGTTTTCTCCGTTAGCTGGTATTCTTTCGCTAGTTGGAGTGCGATTTCCCGTTggc
gcttctcgtcgccatTGCGTAGCTTCCGCTGAGTTCACAGGGTCGTTCTTAATATTCGACGTCATTGCTTTCAGGGTGTACTGAGCGTCCCAGCCGTGCA
CAAGGTAAAATGGAGTCTCCCGCCGAGTTGTGTCTCGCGAGTAGTTGATAGCATATACCATCTTCTCAGCGATATCATCCCAGTCAGCTTGTAAGGGATC
CTCCACATAAACTCGGACTGTCTGGATCATCGTCTTAACCGAGCGCTCCTGCTGTCCATTTGCTTGAGGTCGATAACTCAGCGTGGCTCTGGATCTCGAT
TACATCAACTCAGCGAACGCTTGGAAGACTTCACTCATGAATCGTGGGTTTCGATCGTGCCGGATCAGCGATGGCGCTCCAAACCGCCGGAAGACACATT
CCTCGAACGCTTTAGCCACTTCCAGTGCCCCAGTGTCGCTCATTGCTCTAGCGATCACGTATCCGGTGAAGTGGTCTTGAAAGAGAAGCAAAGCTGTGTT
ACCTCGCTGAGTTCTTGGTAGCGGAATAACAAAGTTCATTGACACCATCTGAAATGGTCGGTCGGACACCACATTTCCTGGCGAGAAACCTCGCAGTTGG
GGTTTGCTTTTGCTCGTGCTACAGTCTCCGCACCTCTGAACATGCTTTATTACATCAGCGTACAAGCCAACCCAGTAGAACTCGGCTTTCACCCTATGGA
AGAACCGTACAATGCTTTGGTGTCC