Description :
From Genome Similarity Track
Location :
Scaffold_507:4849- 6177
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_507-fgenesh-gene-0.660S ribosomal protein L6

Sequence
1328 bases(100 bases per row)
GCGCTTAGAACTTGAGCTCGTGGGCGCGGTCGTTCTTCGTGAGCGAGAACTTGGCGTTGAGGTAGCCCTTGAGGAACTGCTCCTTCTCGATGTTCTTGAG
AAGAGCCTCGTCGACGGCCTTCTGGTCCTTCTTGCGCTGCTCTGGGATCACAGGGGCCTGTAGGAACATCATAGGGAACATCAGTACCGCGTGGTGGAGG
GAGCTTTGGCACAGCGATCCCAAGCGCTGATGATTTGATCGGACCAAAGGGGAGCGGTGGCAAACCACCACTCAatACCCAGAGGCCAATGATCGAAATA
GAAGGCACAAAGCAGTATCGCCCCAAGAGCGACCACTTCGGCCAGTTACAGCAAACGAGAGACGCCCACGTGCGaagacaGGGGATAGAAGCAGAACTTA
CGGCGCTCGACTGGGCGaagaaCTTCTCCTCCTTGGTCTTCTTCGACTCCGACTTCTCCTTGGCGAAGTACTTGTCGTCAATGGCAGGgAGCGAGACACC
CTCGAGCGACACCTTGGTCGAGGTGGCGATCACGTAGGCCTGGTTGACACGACGGAGCGGAACACCGTTGACCTTGTATGGGCCTGAAAAAAAaCACACT
CTGTAAGTCACGAGGTCGAAGGAGCCATATCTGGAGGAGCCGTGATTCCTCAGCTCTCATAATCTTTGCAATCTCCGGCAAGTGACCCCACTCACCTCCT
CCCAAGCCTCAACCCAAAAGTGTTGGCTTGTTCGGAGGGCCGCTCGTTCACGACAGCTTCTCAGCACGATACTACGCTTCTGCTTCAGCATCCGGACCTC
TCTTTGGCGTCGTCTGTCTCGGCTTCAGCCCGAGGGCCACGCCTCCACATCTTCCGCCTCAGATACGGTCCGTCCACCGCGCATTCACGTCCTCCCGCAC
CAATAGACCACCGCTTCAGAGCCGCAAAGACTGATGTCGGCAGCCTCTCGCGTGTCGATTTTCATCATCGGAATCGGGCTCAATAGATGCTGTAGGAAGG
AACTATACTCACCGGTGACGAGGAGCAGACCCGAAGCGAGaTGCTTAAGGAAGACAACGCGCTTGCCACGGAAGCGGCCCGACAGAAGAaTGAGCACAGT
GCCCGGGGTGATCGACTTGCGAAGCTTGGCGACCTTCTTGCTGTTGCGCACGGTCTTGGCCGATGGCAGtGGCTTTGGGATGTAGTCAGCTGGGTACCAC
TTCTTGGTCGACACCTGCTTCTTGGCGGTCACCTTCTTCTCACCGCCGGTCTTGACGCGCCACTTGCCGTTCTTGCGGCGCTGGGCGTTGGCCGAGTAGG
CGTTGATGCCACGAGCAAGCTCGAAGTT