Description :
From Genome Similarity Track
Location :
Scaffold_1306:4848- 6163
Transcript NameFunction/comments

Sequence
1315 bases(100 bases per row)
GCAGAGTGTGGCGCAGTCGAACCCCTCGGGTCCTGCATCATACGCCGCGCGGCAAGGAACTACGAAGCCCGTCGAATGTCGGTACCGACGTTCGACGGCA
AAGAAGCAGACAGTCTTGTCTTCTGGATTCGTGAAATCGAGATAGCGCTGAGCGCTGGGCAAATCTACGAGTCAAGAGCCCAGTTGCTTTCGCGCTTTCC
AATCTGGGAGGGCGTGCACGCGCATGGGCGATGACACGAGAGACTTCGTTTCCGGGGTATTTCACCTCGTGGGCGTTCATGGAACAAGAACTGCGTTCGA
CTTTCCTCCTGGCCAATGTGGCCTACCGTTACGGGTCACTCTTTTGCTGTGCAAGCAAGGAAAACGCACGCTTCAAGATTACGTCATGGAGATGCAGAAT
CTCGAGGCTGCCATGGCAGGTGCTCCCCTCTCTGAGGGCGTTAAGGTGACGGTCTTCATGGATGGCGTCCGTCCGGGTCCGGTCCGGACTGAGCTCATCC
GCAGACAGCCAAAGTCGTTCAACGATGCCGTGCACATCGCCATGTTGGAAGATCATTGCGTGCGCTCTGCGCAGGGTTACGCGGGTCGCGCATAGGCTAC
GGAAGGTCCCACTCCTATGGAGATCTCGTCGGCCGAGTCGGCTCGTCCCCAGCGCAATCAACGCACGAGTGGTCGCTGTTTTGGCTGTAACCAGCTTGGT
CATTTCCGTCGGAACTGCCCAACGAATCCGCGGAAGACGGGTCGCGGCAAGGCCGCTCCGTCACTCAATGTTGATCGAGTCTGCGGTGTCGGAAAACGGC
GACTCTCATTAGGTGCGGGACGCCCTGCTGGGAGACATCGCTCCTCCTCGAGGTCGGTAGCCCTGCCACCTCCACCTCCTGGGGAGCAAGCCCCAGGGAC
GACACTTCTGTGTCTCTCCGTGGCCGCCGCGCGGTCTAACCTCTGGTTGTCACAGCCAGCGTTAAGGGATATGACGAGCCGTTGAAGGTCCTGATTGATT
CGGGAGCGTCCTACAACTTCGCGACGAAGGTCAGTGTGGCTAGGAACAGCGCATTGTATGCTAGTGCTTTGGAAGCATCTAAGCGAAATACAAACGTATC
TGTTCGCCTGGCGACTGGATCCATCGTGTCTACACGGAAGGTTCTTCTATCCCTAAACGTCAAATTTGACGATTTCAACTCGGTCGAACCGTTCATTGTC
CACGACATGGACGATCGGTACGATCTTATCCTCGGCATGCCTTGGCTTGCTAAACATGAGCCGTGGATTGATTGGAGAAGTCGCATCATCGGTGCTAGTC
ACAAGTCCCTCGCGG