Description :
From Genome Similarity Track
Location :
Scaffold_51:48478- 51066
Transcript NameFunction/comments
Physo_137120pol protein

Sequence
2588 bases(100 bases per row)
CCACACCAAGGAGCGCTGGAACGCGAGGATGGCGACCGAAGTTGACGAAGAACGGGGACAGCCCGGTCGATGCGTGGACATCGTTGTTGAGGGCGAATTC
GACCAGGGGCAGGAAGGTGCTCCACGACTTGAACAACTTAGCGAAGCTGCGTAGTATGTCTTCAACAGCACGGTTGGCGCGCTCAGTTTGGCCGTCTGTC
TCCGGATGCGACGCGATGGACATGCACAACCGCGTCCCTAGCAACTGGAAAAGCTCTCGCCAGAAAGCAGACGTAAAGCGAGGGTCGCGATCCGATACGA
TGGAGGACGGAAGCCCGTGGTGGCGGTACACCACGTCCACGAAGATCGCGGCGGTTTGCTTCGCCGTGATGCTGGCAGCAACAGGAGCAAGATGGAGCAT
CTTGCTGAACCGATCAACGAAGACAAGCACGCCAGTGCGCCCTTGAGTGTCTTGGGGCAGCCCGAAGACGAAGTCCATGCTGACAGACGTCCATGCGTCT
GTGGCGACTGAGAGAGGTCGAAGCGGAGCCTGCTTGGACGGATTCGGCGTCACGCGTTGGCACGCTTCGCAGGAGCGTACCCATTTCCGGACCCACTTGT
ACATATGCGGCCAGTAGAAGTCTCTGGACAGCGACGCGAACGTTTTCTCGCGTCCAAGGTGGCCGCCGCTCGGCGTGTCATGGAACTCGTGGATCAGCCG
AGCTCGGAGATCGTCGTCCAGAGGAACGACGATGCGCGGGGGATCTTCACGGTCGACGCGGGAGCGGCTGCCTGGAGACAGCTTGCGCTTCGCCACGGCA
CCAGGGTCTCGCAGGAACTGGATCAGCTCCAAGCAGGACGCGTCCTCCTTGTACGCGTCCACGATCAAGTCACGGAGCGGACTGGTCGCTGCAACCTCAA
CAGCAGCGACGTCTTCGGCAGTGCATACGGCGCATTCGTCGTCGTCCTCGTCGCCAACTGCGTGGCGACCTGACTGCACGTAGTGAGGCCGACGCGATAA
CGCGTCGGCAAGGATGTTGGTCTTGCCCGGCTTGTAGTGCACGACAAAGTTGTACTCGGAGAACAGGGACAACCAGCGCGCCATGCGCTGGGACAAGTGG
GGGCTCTTCGTCGCTGTCCTCAACGACGCGTGATCGGTGTAGATCGCGAAGGTCTGCTCGCCGAGGAGATACACGCGGAACTTGATGAGGACGTAGCGCA
TGACCAGCAGCTCCTTATCATGGACCGGATAATTCCGTTCCGTCGGCTTCAGCTGACGCGACTGGTAGCTGATGACCCGCTCGCGTCCTTCGTCATCGAA
CTGCATCAAGGCGCATCCGATCGCGAAGTCGCTCGCGTCGCACACGACATGAAAGGACTTCGAGTGGTCTGGAAGCACGAGCACAGGCGCGGTGGACAAG
CTCGACTTCACCGCGTCGAAGGCAGCTTGGTGCTCGGGACGCCACGACCACGTGGCGTCTGCCTTGAGGAGTTGAGATAGCGGGCGAATCGTCGAAGCGA
AGTTCTTCGAGTAATCGTGAAAGATACGTGGCGAGCCCCAGCCACTGCCGGAGCTGCTTCTGGTCCTGCGGCGTCGGCCATGCGCAGATTGCCTCGATCT
TCTCGGGGTCGGCGCGGACACCGTCCTTGCTGACGTAGCTCCCGAGCACAGGGATCTCGGGAGCGCAGAAGATGCACTTCTTCAAGTTGGCGTATAGCTT
GTTCTCCTTCATCACCTCGAACACCTTGCGCAGGTGTTGTAGGTGGACCTCAACGTCCGTCATGCCGTCCTCGGCACGACTGTGCATGAAGATGTCGTCG
AAGTAGCTGGGCGCGAAGTCTCGGTACGGCCGAAGCAAGTTGGACACCATCCGGTTGAAGGTGGCGGGGGCGTTCTTGAGTCCCTGCGGCATCACGAGCC
ATTCCCACAACATCCCGCTGGGCGTGCTGATCGCTGTCAGCGGCACATCGTCTTCGCGCATCAAGATCTGATAGAAGCCATCCATCAGATCAATGGCACT
GTACTTCGTGCTGCCAGACATGGTGTCCAGCACCATGTCCTTCCTCTGGATCGGCGTTTGCGCCGGTATGGTGGCCTCGTTGAGCTTGTTGAAGGCGTGG
ACGATTCTCCAGCCGCCGGTTGCTTTCTTCACGCAGAACATCGGACTGGAGTGCGGCGAGAGACTCTCGCGAACGTGGCCGGCTTGCCGACGACTCTCGA
AGAAGGCGTCAATGGCTTCGACTTGGTCGCGAGGAAGCGGCCACTACCGCGTCACGCAGTACTTCGCACCGGGCACGAGGTCAATCTCGTGCCGAACACC
GCGGTCGGGTGGAAGATCGCCTGGGACCTTGTCCGGGAAAATCTCCATGAACTCGCGCACGAACGGAGCGACTGGGTTACCGGCCTCTTCGAGCGCCGGC
AACGACTGAGCTGCGTAGCGGGCTTGACGGGCGTTCTTCGGCTCGGCTCCTTTTGGGCGCGTCCTGGCGTCGGAAGCTGGGTCCGACGCACTGGTTGCGA
CGGCCGCAACTGACTCGGCGTCTTCGGCGACGATCATGCACACCTGCTCGATCTCGCCCTTCTTCAGGTCACGGAGGAAGTGTTTCCA