Description :
From Genome Similarity Track
Location :
Scaffold_76:48474- 64915
Transcript NameFunction/comments
Phypl_g2524hypothetical protein
Phypl_g2525hypothetical protein
Phypl_g2526hypothetical protein PHYSODRAFT_320441
Phypl_g2527tRNA pseudouridine synthase
Phypl_g2528hypothetical protein PHYSODRAFT_320443

Sequence
16441 bases(100 bases per row)
cAAAGACACGAAGAGAGTGCCAGCTCTTCCGTCGATCCAGGTCGCTCCCTCTCGCTCGGCATTTGCCGTAATTGCCGCAGCAGTTGCCATCGCCCCATCA
TGGCGGAGCCGCGCAGCATTCGCGGATTTCTGGGGAGGCACCGCAAGCACAAGCGCTCGTCGGccgactcgctggacgcgGAGGAGCCGCAGCACGCCGC
CACCGACGCCCCCAGCGCccccagcagcctcagctcgAACACCACCGCCGTGGCCATGGAGggctcgctcaagaagcgcgcggccAAGATGCCCGTCATG
CACGACCGCTACTGCGTGGCCACGtgggagctggacgccaacgAGCGCAAGTGCGTCATGCTGCGCAGCTACAAGAGCCGCAAGGCCTACGACGCGCACC
CGGAGAAGCCCtcgagcgtgcagcagctcaagtgcaTCAGCGACTGGGACGGCAAGACCGGCTTCCACCGCTACCAGCACGCCTTCACCATGGAGACGCG
CGACAAGAAGCTCTCCCAGTGCGTGGCGCCCTGCGCGGCCGACAGGGACAAGTGGGTGGAGCTCATGGCCGTCCAGTCCGCCTTCAACAACAGCCGCGAC
ATGCGCCtgggcagcgtcggcagccTTGTGCCGCTCCGGCGCACGCAGAGCGTCGAGTCCGCGGCCGACAGCGGCAAGCCCCGGGCCTacaccagcgcct
ccatcggCAAGAAGAGAGGCGAGAGCGACGTCAacgctgccgacgccgacCACTCGACGGACTCGGAGGACCAAGGCAACTTCCCCGGCCACGACGGACT
CTTCCGGACCACGTCGGGCGCGTCGACGAACTCGTTGGAGCTGCCCAATGGCGACAAGAGCGAGCCCGCCGACTGGGGACTCTACGGCGAGGCCAACGGA
GAGACCAAGTCCAAGTACGAGGTCCAGGACGACACcaagcccgtgctgctggacaaggagctgctggatgcgcgCGGAGagaccaagacgctggcctCGG
ACAAGTTCCTGTTCGAAGACGCGGGTGCCAGTAGATTCGGTGCTGTTGTCGTCAAGGGCGCGCAAGgaagcgacgaggacgaggacgccgccgagttcat
cgacgaggacTTCGCCGCTCGCGAAGCGCAGAAGGAAAACGAGAAGAACATGAAGCGCCGCgcgcagaagctcgagtCCAACCGCGACCTGTACGCCGAG
ATGGCGGCCGCGAGACTTGCCGACATGCGCAAGGACGCGCGCCACCCGAAGAAGAGCCACAGCCGTCCGTCagctggcagcgacgagagcgacttggagg
agcacgacgaggaccAGTCGATGGCTGTCGAGGGCGAGATCGAGGTCGAGGGCGTCGCCGAGTTGGAGGACATGGCCCAGCGCCGTAGCAGTATCAGCcg
tcgcagccgtcgcagctccaagagccacaagaagagcttcgtgagcagcagcgacaacacgAACAGCGTCAACGGTGGGTATGCCAGTGgccacgacgaa
gaggaggtagagcaggaggaagtgcctgctgctgccgccgccgccgcgggTTCGACTGAAGCGGAGAGCGCGGAGGCTGAAgagctgcgcctgctgaaga
agaagtaccGCGCCGAGCGCCGTGCCAAGAAACGTctggtgaaggagaaggaagaggaagagcggACTGCCTTGGAGGCGGCTGAGCTCGCTCGTGCCCA
CCGCGAAGAACAGCGTGCTCGTGAGGAAGCCAAGGCccgcgaggagcaggagaaacGCGACAAGAAAGAGCGCcgcgagatgaaggagaagctcaagcgc
gagaagaccaagcagcGTCAGGCTGAGGCCGAACTCCGGAAACTggtggagctgaagcaggcTGAGGAGGAGCGTCGTGAGCGCGAGCGCAGGGAGAAGA
AAGAaaagaaggacaagaagaagtccaagaaaAAAGAGAAGTACACTTCGCCTGCTGAGCGCATccacaagaaggaggagcgtgacgccgagcgcgcggc
tgagtctgctgctgccgcggaGGCGGAAACTGAGGTCTCGAACGCCCTGGTTGTCGTGGAGAAACCGGTGGAACCGGAACCAGCTCAGCAGCCACTTGCG
GCTCCGAAGCCAGCTCCGACGCCGGCTCCCACGCCGGCTTATTCGCCTGTCCAGACCGAAGCTCTCTCCACAGAACAGGCTGCACCCGCACCTGCTCCTG
TTGCTACCCCTGCTGTCGCTCCTGGTGCACCCGCCGCTGCTCAGGCGATGCCGATGTACCAGGTGGTTCCGCCTCCGTTCATGCCAACGTATCCGGCCGG
CCCGCAGAGCATGCCTGCGTACGGTCTCGCGGCAACGTTCGGTGCGTACCCTCCGCTGTACCCTGCGCCATACAGCTACGGAGGACCCGTGGGACCGCAG
CCTGCGTTCATGCGCCCGAACATGGGCTTCATGGCTGGACTTAGCTCGATGGGGTCGTTCGGCAAGACGGCTGGCCCTGAGCCGGCGCCTTCCAGCCAGG
ATTCCGCGGAGCCCATGATCGGCCCGCAGCTCCCGTCCCCAGAAAAGCGCGCTACTACCTCCTCAGCAGGTGCTAGCGCCCCTACCTCCCTGCCCCCACC
GGCGTCAGCGGACAAGCTGACAAACCTGCCGGACCTGCCGGACGTGGTCGAGTTTTAGGAGATATGCTGGTTATAAGTTAATTGCAAACCTTTTTGCCCA
TTCAACGTGAagtcgacgaagatgccTGAACCAAGCGAAAGGTGTGTACCCTATCTGAGAATTAACTACGGCTACAGGTTGTCGTCTGGAGTATTCTATT
GCCACCACTGTGAAAGTAGGTGGCGGGGTCGTTTCGTGACGGACTGGCTGGGCAGCGACCCCTATAAATACTGCCAGGGCGCATCAGAACCTGGCTGCGT
ATTTGCCTAGACCCCCAATCATGCGCGTGATGCCGGCTCCGGCGGAGTCGCGGCCGcccagccgcagccgccgccggtcGTCGGTGTCGCGAGTGCCGAG
TCGAATGACGatgcttctgcttcagcaacgcGCCCGTGCGGGCTCGTCAGAACTCCTGATGGCCGAGAACCGCAACGCGTTCGACCCGAGTTCGCGGTTC
ATCCGAAtctgccagcagcttcgactcgCGGCGATTCTcttggagctcgtggtgaTTCCGTTCCTAGCAGCGTTCCACCCCGAGACGTCCCGCTCTCAAC
TCGTGGCCATCTACGCCTGCGAACTTTTATTCTCTGCCGACATCTACGTGCAACTCAACACAGGTTACTATGAGAACGGCAACGTGCTACGAGACGCCCG
GAAGGCTCGGCGGAAGTACCTCTCGTCGCCAGCATTCGCAGCGGATCTATTGGCACTCGTGCCGTTGTCACTTGTGTTGCCTACCAGGACGACTGGATCA
CGATCGATTGCCTTGTTGGAAATGCACAAACTTGTGCGCATGTGGCGACTACCAGCTCTCACGTCCAACCTCGACGACCTCTACGCAAGACATTTCGCGT
CActcaagctggccaaggtgctcGGGTTCACGCTGCTTTTGACGCATTTCGTGGCCTGTGgtcgcttcagcttcggctACAGCCACCCCGCGCCCGGCGA
GGAACCAAACCACTGGCTGCCTCATGCCCCACATGATGGACATCATCACACTGCACGGCGACAGTATCTGATGTCGCTCTTCTGGGCGTTCGGACTACTG
ACAGGAGGCTTTGAGGGCGAACTCCCTCACCACAATGCTGAGTTCGCGTTCACAATTGTTGTGAGCCTTTGCGGATTTACCTTGTTCACGTCACTATGCG
CGACGTTTTTCCTTCTCTCCAAGTGTGAAAGTGGCGACGCTGAGCTAGCAGAAGCGCGTGTGCACCAGTTTCAGCACATTTTGGCCTTCCACAGGGTTCC
AGTTCAGCTACAGGCACAAGCCGTCGACTACCTTCAGCGTTATCATACACAAGCTGAGGCCAATGACCGTGAAGCAGCCCGTCGACTTTGCCCTTCGATT
TCAGTGGACATCCAagtcgagcttctcgaggcCACAGTGGCTTTGGTGCCGGTGTTTGCTGGTTGTGACGCTCTCTTCATTCGAGCGGTGACTCGCCTAC
TCGAATTGATTGCATTGCCAGCCCGGGTTGCTCTGTTTCGTGCAGGTGATCACGGAGATGCAATGTACATTGTCCACACTGGTGTTCTACACACTGTCGT
GGGCGGTGTCAAAGTGCGGGAGCTTCGGAAAGGGAACTTTGTTGGCGAAGTTGCAGTCTTTGCCCGGCAACCACGCTCGGCCACGGTTGTCACAGCTACG
TATTGCACCTTGTATCGACTCTCACGCACCCACACTGACAAACTTCTCGAGGGATACCCGCAATACGCTCAGGTGATCAACCGGACAGTTGCTGAAATGC
TTCACAAAAGCAGCACTATCCCCGCTACTGCCCCGGAAAATATATCTGGTGTCGCTGACAACTCCAGACAAGAACTAGAACCCAAAACGAAGTTGGCACT
GTCGTTTGTGCACCTCGTCCGGCTCAAACAACTTCTACATGCTCGCGTTCTTGCAAAAAAGGCCAGCGAACAAACCATAGTTGGCAGTGGGGATAAAGCT
TTGAACCAGAACGAAACTTTGGCAACAGCACCTGGAGATTCTTCCCGACCGCAAGAAGCCAAACAGGTGGCAAATATTGCTCTCCACCCTCTTCACTTGC
CACCGCTAGAAGCTCGACGCGCTTCTGTTGTGGCTAAACCCTCGATGACCCCGCGACACTCGTCACCAGTGCCACATCCAATGCTACAAAACTTACGCAG
TGACACTTTTCGCAGTGATAATATCCTGTCGTCACGGAAGCGATTAAAGAATGGATCGCGCCCTACCTCTGTCAAGATTTTCCCTGCTGTCCCTCAAGGC
ATGTCTGGAGTTGCTGCTTTAATGGAAcaagcaactgcagcaccaaggcGCAGTAGTCAGCGAACATCGTTTCTTGGCAGCGGATTGAACAGACTCACAA
CGTTTCGAGACAACTTTTTCCACGATAATGCGGTTAAGCCATCCGACGCTATCCAGGGTTTTTATGAGCAGTTCCCCCACCTTGCGGCATCTTCAAAGCC
CCGTCATCGCTGGTGGCATCGCCTGCTTATGAAAAATGGACTAGATGCCGAAACAAACTGGAGGATGGCGTGGATTGGCATGGTAGCAGCAGTGAACTGC
TACAATTGGGTCCTTATTCCGCTGTTGCTTTCGTTTTCGTCTCTGGATGACTTGTGGACAAGATGGTATCTCATAACGCTGAATGCTATCGCTGATTTCG
TTCTCTGGGCAGATGTCTACGGCAATCTGCACTTGTCGTTCTCTGTCAACTCTGAAAAGATTTTAGAACCAAGACGAACTGCGGAGCGCTATGTTTCTAG
TGGGAAGTTCTTCGTCGACTTGTGTTGCGCGTGGCCGTATTGGATATTCACGCTCCGTAATCTCACTCATCCGGCTTTGCGAGTTCCGAGGCTGCTGAGC
GGCTATCGAATGCATGGTCTTGTTGGTGAGATCGAAGCGTATTTTCGACTAACCAGCAAGCACAAACTCATGCTGCTTGCGATACTGTTCTTGATGTTCT
ACCATATCGTTGCCTGTTTGTATTTTAGCACCACGTATCTCGATGGCTACAGTACGGGTGAAAACCAATGGCTCCCCTCAGAAGATGTGTATCTTGAGCG
CCTGAACGCAACGCATTTTCAAACAATCTTGGGGATCATTCTTGCCGCCGATAGTTCGCATGTCCAACAAATTCGAGCTGAACAATACTCCCGATCATTG
TATTATGCAGCAAACGTCTTGGCTGCCGTTGGTCGCATGGTTGAGCCTGCCAGTGATACAGAGTACGGTGCTGCTTTGATTTTTATGCTGAGCGGGTTCT
TCATCACGGCTATCGTCGTGGATCATGTGCAAAAAGGCTTCACAGCATCAGCTCTAGAGCAGAAAGAATTTTTCGCGGCCCGAGCTCGAATTCAGCGCTT
TCTCAAGAGGCAAAATGCTCCGCTATCAATCCACTTACGCGTGAACTCATTTTTGGATTTTTGGTGGTCTGCACACCGCGGAGCAATTAtcgacgagttg
ctggaggaTCTTCCGGCTGCCACCAAGCGAGATGTTGTACGCAGTATTTGCACACCAGCGATGGACTCGTTAGAAATGCTATGTGTGAATACGACCATGC
AAACTACTACTGAAGCCGGCAGTAGTACTAATACCACTACAACCAAGCAAGAAACCTCGGGGCCGTCGCTACAGGAGCAGATAGAAGACATCTTTCTGGA
TAACCTGAAGTTTGTGCTGTACGGCCAGGGGGAAATTATATACCGCCGCGGGGACTACGCTGCTGGGCTCTTTTTCCTGCTGGAAGGCAAGGTGTCTATA
ATGATAGATGGTGAGGTACCACGACACGTCCCCCTCGGTGGGTTCTTCGGGACGGCTGCATTTCAATCGTCAACCACTCGGGACAGACGTGAGAGTAGAC
GGTGCTCTAGCATTAGTGCGTTAGTGGATGTCGGGTATGAGGAACGGGTGACTGCTGTGAGCGGCTGCATCGTTGTGTACATTTCACGTGAACATTTACA
AGCCATGCAGCGTATTTTTCCAACTCTACCTGCGTGCTTGCGGAAATTGgagcagcgtctgcatgATCCACGTGTGGCACGCTCGGCTGATCTACGATCG
CTTCAGCCGCGAGTTGCTCTTGGAGTCATCGGCTTGAACAATCCTACTATGCGTCGTGCACTACGCCGCAAACAATTGACCGGAATCGTTCAAATGCTAG
CGAAGAACATGGAGTGGTGGCAGCGAGACACTGCAATAGACCCGGACTGGCCGTTCGTGGGTGTGTGGGAGGCAACGATGTTGATGGCGTCGACTCTGCA
GGGAACGTTGGTGATGTTCTACATTTGCTTTGGCGCTAACGAAACCTCGGGAGGTCGTGCATTTGCTGATGCAGTCACGATCACACTTGAGCTTCTTTTT
GTCCTCGACGCGTACCTACACTTAAGGTTGGGCTTTTACGAATACGGCAATAAGGTCATGGATTTAGCGATCATCCAGCGACGTTACCTGCGTTCGATGC
ACTTCGCCATTGATACAGCAGCTCTCATACCGCTATTTATTGTGAACTGGTCGCTGCCAACCAGGCATTTGGAAATACTGAATGTCAACAAGATGCTGAG
ATACTTTAAAGGCTCTAACCAATTTCGCACCCTCGAGACAAAGTACGTGACACTCACCACGGAGCTCCGCCTTCTCAAGCTCGTTTACTATTCCTTTCTT
GCCTCGCACATGTTTGGATGCATCTGGTTCGACTTTGCAGCCCATAAAGCTAGTCCTCACATTGTAATGAGCGGTTCTGATAACACGGCGACGTTATCGT
TCGGGGCCACGATGTGGGGACCGTACAAGTCATTAGAGTCGGCCGCGCGTGGACTTCAGTACCTTGCATCAATTTTCTGGTCCTACGGCCTGATGTCCAA
CTCAAGCCAAGGGGAGCTGCCTAAGACAGCAGGCGAGTGCATTTTCAGTGTGATTACGATGACGACGGGATTTTTTCTTTTTGCGTACGTCGTTGGCCAT
ATCTCAGATGTGATCGAGTTGCAGGACTCTGAAAATCGGCATTTTGTCGCCAAACTGAGTTCGCTGCGCCAGTTGCTCCGGCATTTTGACCTGCCACCAA
GCGTCGAAGAGAAGTTCAAGAagtttttcttcttcaagcgATTCCACTCTATCACACAGGAGCATgtgctcgagcgcgtgctACCGCCCTCACTCGTTGT
AGACATGCGAATGTTCCAGTTGCAGCCGATGATTGTGAAGGTGGCGTTTCTTGTCGGTATGGAGGATTCGGTCACGCGTATGCTGGTGTCACTTTTCACG
CAAGTGTTGTTCGTGAAGGACGAATTTATTTGCCACTTCGGTGAAGAAGGCAGTGAAATGTTTTTCATTTACACTGGCGTTCTCGACATCTACATTCCGA
TGCTGACACCGTCGTCACCCGCAAGTCCTGCTGGGCCAGTCGTTTTCCCGACCTCAGCTTCAGGTGCACGGGTAAGCTTGAGTGGTCTGCATAAAGTAAA
TGAGATCACGGCTGGGAGTTACTTTGGGGAGGCAGCGTTATTCACAAATACCCCACGTAATGCGTACGTGAAAGCTAACACGTCATGCATTCTCTACAAT
CTTTCTCGGCATTCCCTCGAGCTGGTGTTTATACGGTACCCGGAATGGCAACAAAAAGTTCTGCGCATCGTTAAgatccagcaacagcagcagcgacttc
aacgtCTTGCCTatgaagctcaagctcctgatgcaggaggtggaggtcGTCATCGTGGACTTCAGCGAACAGGGTCTCGCATGGATCTTGTCAATGCAAG
GGCAGAGAATATCGAGCAGCTTCTACTTAGTCACCGAATGGGAGATCATGGGTCGGACAACGCACCTCGTCGGATGAAAGTCTGGATCATTCGGCAGTGG
CGAAAccttcaagcagcaaaagTCGTAGTGCGTTGGGTGgttccagcacggcgttgtCTGCATACCTTTGGAGAGCAACTAGCTTTCGGAGCCGAAATTC
AGAGCTCCTTTTATCTCCAGTGGATGCGACTGGTATCAATCTGCACGGTTTACGTGGCCGTCATGGTACCCTATCGTCTAACTTACGATTCCCTCGACCG
GGGGAATATCATTCCTGTGTGCCTTCGGATGTTTGAAGCTCTGTGTGAGGTGGTGTTCTGGATCGACATTTGGTTTCAATTTCATGTGCGTACGAACCAA
GCGGCTATGGAGCTGTACGAACAAGACCAGCTTATAGGATATAAGCGCGAACGACTTGCACTTGATCTTGCAGCCACATTCCCTTTGGATCACTTCGCGA
CGAGCTTTTCGAGTGGGCCGAGTCGGTTGTTGATGTGCAAATGGCTACGACTCAATCGCTGCGTGAAAGTCGCAAACCTTGTGTACTATCGTAACGAAAT
TACCCGCCGTAGCGTATCGTACGAGGTAAATCGCGCTCAAACGCTCTGGTTGTTGTATCTACTGGCCATGTTTTGGACATCCTGCGCCTACTTTGCAGTA
TCGATATACGATGGCTTTGGTACGGAGTGGCAAAACTGGCTGCCGTCGTCTGCGCTTGAATCAGAGGACCCGTCTCCAGAGCTTTTGATGCTGAGGCTCT
TCCGAGGTTTAGCCTTTGCTGTCACTGTTTTTGTGAAGAAAAGTAGGACCTTTGTACCTGCGTCACAGATCAACTTCGCgttcgccatcgtcatcTCATT
TATCGGCCAACTCGTTATGGCTCTCATGATTGCCGAGATGGCCAATGTGTTTCTGCTGTACATTGATAACGAGGTGCAGTTCCGAAAGAGCCACCTCATT
GTCGAGCGCTCTCTTGCCCGATGGAAAGTCAGCACAGCACTAAAGCGGCGAGCAGATAACTTCCTTACATCCTGGTGGTCTTCTCATGCCGGCGTCGATT
ACCAGCTAATCTTTGAGGATCTCCCTGCCAGTGTACGCACAGAAGGTATTTTGGCCATAGCAAAGCAACCTCTCGGTTTGTTCGTTTACCGCGTGTTTCG
CCCGCTACTTCGAGACGGAATGAAAGGCACAATTGAAGGTAAGGCTAAAGTTGCAAGCCAGGACGCGGGtgccgaagaagcagaaaaaAGCGAGCGACCG
GACTACGGTGTTAAATTCCATTTAGGGAACCTCACGTACGCTATTGCGAAGTGCTTGCGCTTCGAAGGATATCCACGAGGAGAGAACATCATTGTGGAAG
GTAGTGTGTGTATGGCCATGTATTTCGTGGTCCGTGGCTATCTACTGTCGAAGAGTGTGTCCAATTCGGGGATGTACCCGGCTAGCCGCTATCGAGGCGG
AGATTACTTCGGTGAAAGTGGTCTGCTAGGCCATTCCGTGAGTCTAACGACGGTGACGACTATTCGTGCCTGCGACCTGTTTGTATTGAACTCGGACCAC
CTACTGCACGTGCTTCAGTCGCACTCGTATTTCAGCTTGGTGCTAGCTACTGCGCAGCTTGCCGTTCgggagaagaagaccacCGCTGAATTTGTGGCGG
ACTGGTTTCACAATAGCGACAATGAGGAGGATAtcgagagcagcgacagcgatagcgacagcagcgatgacgatAGCGAGGAAGGTGATCAGGACAAGGT
ACCCGCGGTGACCAGCAATACTGCCAGAGTCACGAGCGAACACATCAAGCTGAGGCTCAGAAGCCAACAACTGAAGCGAGCACTGCATGGGGCATCCCAG
GAGATGATAGATGTGTGGGAGGAAACGTTTGCACTTTTCATGGAGATGCTAACCCCTAAGGGAAGCATGGACATTATCAAAGGCGCCGCAATGCCCACAC
TCTAGAATAGAACTCTATCGATGCGTCTTCGAGAAAATGAAGAGGACCGCGAAGTCTTTCAAATGCACTGGTCGTAACTTAAATTTTGCTAGTAAATGTC
ATCACCACAGACTtcgtacttcgaagtacattGTTAAAGTGTTGAAGTATGCACTGCAGCAAACATGCCTCGCTTCGGCATTGCGAATAAATAGCTGTGG
TTGGTTTACCAAGCAAGAGATCTGTACTGCGGTCTGTTTCTGGAGTTCATTTAGTCGTCAAGCTCCATCATCCCCTCGAGCCGCATGAGGATCTTTGTGA
GGTTGTTCAACTTCGCCTCAAGCCGCTGTTCTGTTTCCAGAAGGCGTTCCTGGAAGCTCTCCTGCATATcgagaagccgaagcagcagctcattaTCCGG
CATTACCAGATGagcagtgctgctggatgaagatAGTTTTGTCTGGGCAGAAACACCATTCAAtcctgctgcgtcagcactCGGTCCGCTTTGTTGTGGA
GACGAATCGAGGACGGCTATGGGGTCAGTCGACCTAGTTTCCGGGGCTCCAAGACTAACGAGCGTGGTGGATGGCTGCTGGGCTATTGAAATGCTCGGTC
GGCGATGCCCCATGCTGTCCGTACGCATCGCTTTGTTTTGCAAAAGCAATTCAGTCGGCGACTGAATAGCGGTAGTAGCACCCGATCGGCGCCTTCCATT
TGTGGTGGGTGAGCGATGCTGGTGCAGACCGACACCGGGCACAACCAGTTGATTCATGAAGGCTCGGTTTTGAAGAACCTCGAGATCGTTGCGAAACTTG
GCCAGctcatcgtcttcaagcATGCCACTGTTGTCCGTGTCGTAGACGTTAATGACGTCATCGATATCGAGGTGAATTCCTTCCGTCACTGCGTGGAATC
GCTCCAGGATACCTTCGATCTCGTTACGGCAAATCATGCGTTTTCCTTTGAGGAAGTCCACGTTGCTTTTCATAGTTTCGTGCATGACCGATTTCATGAC
TTTCTGGAAGTTCGTTCCGATGACCGTAATCGGCAGTGCAAGCACCAACATACCGGTGAGGACAGTGCAACATCCTACGACCTTGCCCATCCAAGTAACT
GGCGTCATGTCGCCGTAGCCCACAGTGGACATGGTCACGATGCACCACCAGAAAGACGTTGCAATGCCTTGGTACGGATTCGGATCCACGCACACGCAGG
CTTCACTTGTACTAACGGACGCTACTGCTGCGGCTGTAGATACGGAATACACAACGTCTGTGGTGTTGACGTCGCCCGAGGAATCGACATCACAATTTCC
CATCCATCCGTCTGCACGACATCCATCGTTGGTAAACTCAGCAAAGTAGATGGCCGACGAGAAAATAATCATGGCAATCGACATGAGAAAAATCAGCATT
GTCAGGGGCTTAATGCTGATAGAGATGGCCTGTGTGAACACCTGAATTGCTGACGAGTACCGTGACATCTTCAGGACACGCGCCACTCGCGTGAGCCGCA
CAATTCTAATGGCACCGAATGATCCAGCGTTGTCTACGGCCAAAAGCGAATCCATGTAAAACGGAAAGACTGCAACAAAATCTATCCAGTTCGAGTAGTC
TAAGAAAGGTGCACACGTTTGCGGCTGTCAGTATCAATACATACAGACTGCAGGAACATGCATCACGGATAACAAGAGGCGTACCTTGGATAAAGACCAA
TTTGCTGGGGCACACGAGAAAGCGTCCAATAAGTTCGAACGAGAAGACGCCTGCACAAATGGCTTCCAGTGTGGTAAGCCCCACCATGTACGGATCGAAA
ACCGCCTCCGTTtcagcgacgaagacgaatGTAGAGAGGATGATGAATCCATATATGCCAAGCGAGAAGTAATATGCCGGCGTGGATGACTGGGGGTCCT
CGAAAAAGACCCATAGTTTTTGCATGCATCCCACAGGCTCGCCGGCATCTTCTGCCTGTGAGTCGGAGGCAGTCCTGGAGCCTTGTCGCGTCAGAGTAAC
CTTTGCACCCTTGGAGACTGGTAATTCGGGGTTGCTGCCTTCCACTGTGGTTAAAATTGAGTCTTCCTCCGGCGTTGGTGCCACAGACATTGATCTGCGA
CTTCGTTGACTCCTCTGCGCCTTGTCTGTCTTAGGGCGTGAAAACGACGGTAGGTGGGCTTGAACATGGAACAATCTCGAGCTGTGAAGAGCTGACCGTC
GTTTGGACTCGCGCTCGATCACCTTCGAAAGCTTCAGAGCTGTATCTGATAGCTCCATAGGCCCCAGAGTCCCCTACTTCAAGTAGTTTGTTTCGATCAA
ATGCAGGCCGGCGGcaaacgacagcagcgaacGCGATAAGCACTGGAGCACGGAGAGGGCTGGTGGAGACGGTAACCAAGCCCAGCGCACACTACACGCA
ACAATTGAATTCCTCTCACAAGAAAAGGCAAGCGTGCAAAGCAGTTAGTTCCCTAAAAATATGCCGATGGTTTCAGAGCTGCACGGTTAGTGTTATCGCT
GCGGCGAAGCAACCGCTTTATAGTGGAGCGTCCAGCCGCAGGTTGCTATGTCTGGCACCTGTCAGTAAATGCAAATCTACCCTATGATACAGTAAGCATA
AGTCCGCAATCTATTCATGAAGATAATAACATCCCACATTGCACTCTcagctggaagctggcgccCCCTCCGGCTTCGCTACctcttctgcagctggtgc
cTCCGCACTGTTGCTAGCTTGAGCGGCGActcctgcacgcgcagccGTTGCCAACTCACGCCTGCCAGCACGATCCGTGCGTAaggcttcctcttccttc
tccttcttccaTTCCAGGAAAGGCTTTGCAACGTAGTCAAATGGCAACACCTCCATAGTACGCAGCCATTTTGCGTATGTGCGGGTACGCTCTTCGTGCT
TCATGATGTGATCGAAGATAAAGTCACGCTTGAATTGCTCAACcgcggcagcaacggcgggTTCCTTCAGATCAAGCGGCGGGTGAGACGTCTGGATCGA
GTCCTCCATCTTCATGTTGTACACCTCAAAGTGCGCTTGTGCCAGGTACAGTCCGACACTAGGCGCCTTGGGTAAGTCCATCTTCGTCAACGCCATGGTG
CGCTCAATCGTCGAGGGTTCCGTAACATTGGAGACGATCTCCACGGCAGTGCCTATCATCTTGCGGATGTGGTGCAGTAAGAAGCTCTGGCCCACGACAC
GCAAACGCACCCACTCCATGCCATTTTGCACGAACGGGCGATCGGCCTCGAACGAAATGATAAAGCGGTTCGCCTGGGGGTTCGTTGGCTCCATCTTGGA
CGTAAAGTTGTGGAAGTTGTGGGTTCCAACATActgcttcaacgtggtgttgagctgttccagcgtctcgtcgcTGAGTCGGAAGGCCTTgtgcgcctcc
agcgtcgtgttgTCAATtaccacgtcgtcgtcgaagccctCCTCGGTGTCGCGCAGGTCCGACGGCCACTGGGTCGCACCTtccgccatcttctcctcgc
tcttctcAGCATCCTTCGACGCAGCCGCACGCGCTCGCTTGCCGAAGATGAACGTGGGCGCGAGGTACTCGTAGGTGCGCTGGTCGCAAGACGTCTTGGC
GTTGAAGTTCTTGGTGACCGTGACCATCTGCGTGACGCGGATGTCCTCGGGCAGCGCAGCGTTCGCCTTGGCGACGAAGGCCGGGATGTCGTCACCGacg
tgcagcttggccgtcagcagctgccCGGCGGCGTGCACGCCCTTGTCGGTGCGGGCCGCGCGGCTCCAGCCGATCTTCTGCAGGAAGCCGTAGTTGCTCT
CGGCGATGCCGCCGGCCTCGAACAGCgcacgctccagctccgcctcgaTCGTCTTGACGCCCTCGTTCATCTGCATGCCGCTGTAGTTCCTGCCGCAGAA
GGCAACCCACAGGCCGTAGCGGCGCttgggcggcagcgacggcgcacccgcagccgccgccgccggaGATTCCAAGCGAGGGCGCTGAGCTGCGTACGAG
CCCGGGTGGATGGCGTCCGACCGGTCAGCGCGGCGGTCTGCGCGCggctccttgtcctcctgctgctcgtcgccatcgtcgcgtCGCGCCAGCTTGTTCT
TGCGGCGTACAGCCCAATGAGTCTTCTTCCGCTTGCCCGCCATGCTAAACGCCGAGCTAATAATGGCTGGAGACCATGTATCTAGGGTTTTCCTTAGGGT
TTGTTCGAAACCACATCGCTAATGTACACCACACCAACCCCATCATTCTGAGGGTCGGACAAGCTCACTCGCTCATTATCCACCGCTCATAGCGTGTAAA
GTTTACACTGTAAACTAGCCGAGATGGTGTCGCTGCGAAGCCTCCAGACGCTGCGTtgcgcggcgcagctggcCGTCAAGTCCTCGAGCACCCGCCTGGC
GCctctgcagtcgctggcatCGTGGACGCGCGCCTTCTCGCAGGCGCACACGCCGTCGCAGGTCGTGGACCCCAAGGACATCCTGCGGcccgaggtggcc
aaggacgccaagccgcagctgtcgctggagcgcgagctgccggaTCTGCCCACGCTCAAGCCCGCGAGCCAGCTCAAACCCCCGCAGACGGAGATCTCGG
TGCTGCCCTCGGGGCTGCGCGTCATCTCGCAGGAGACGTACGGCCAGGCGGCCACGCTCGGCATCTTCATCGACGCCGGCAGCcgcttcgaggacgacga
cagtgTGGGCGTGAGCcacctgctggagcacctCGGCTTCaagagcaccacgtcgcgctcgcacgcgcagctggtgcaCGAGATCGAGGACATCGGCGCG
CtcaccacgtcctcgtgCGGCCGCGAGCAGATCATCTACACgatcgacctgctgcgcgacaacgTGGAGAAAggtctggagctgctggccgacgccatcc
TGAACGTGGACCTGGTGCCCGAGGAGATGGAGGGCATCAAGGCCATCATGCGTATCCAGACCGAGGACCTGATAGAGAACCCGCCCGCGATGCTGCAAGA
GTTCATCCACGCCGCTGCGTACGGCGCGGATACGCCACTGGGACGACCGCTGCAGTGCCCGCTGGACAGGATCGACGCGTTGaccgtggagaaggtgaag
aagtTCCGCGCCGAGCACTTTGTCGCTCAGAAGATGGTCCTCGCTGGCTCCGGTGTGGACCACGCGCGTCTGCTCAAGTACGCGGAGAAGTTCTTTGCGA
AGGTGCCTGTGGCCCCGGAGGATACGCCGATGGCGACGCCCTCGAACCCCAAGACACTGGAGCCGGTGATCTACAATGGAGGACTGTATCCGCTTCCGAA
CCCGGAATCGGAGTTCTCGTACGCAGCGCTGGCATTCCCCACGGGTGGCTGGCACGATGAAGACCTGGTGCCCATCTGTgtgctgcacacgctgctcggc
ggcgggGACAGTTTCTCTGCTGGTGGACCTGGCAAGGGCATGTACTCGCGGTTGTACACGAGCGTTCTGAACCGCTTCTACTGGGTCGAGTCGGCCTTCG
CGTTCTCGTCCATCCACGCAGACGTGGGTCTGCTTGGCATCTACGGCGCTTGCATCCCGTCGCACACCAGCAACCTCGTGGCGCTGTTGTGCAACCAGAT
GCTCAGCGTTGCCAACCGACCCGTTGATGCTATTGAGCTTGCTCGCGCCAAGAACCAGCTCAAGTCGTCTGTGCTCATGAACCTCGAGTCCCGCATGATC
CTGTACGAAGACATCGGCCGCCAGCTGCTCACTTATGGCGAGCGTGAGACGCCCGAATCTGTGTGtgccaagatcgacgaggtTACCGCTGCAGATATCC
AGAGAGTTGTGAAGGAAGCCATGCAGAACCCGCCTAGCCTCGTTTATTCGGGTGACATCCCTAGATTCCCGCAGTACCAGCAAGTTGTTGCTGGTATCAA
GGAAGGATTGAGCGAGTAGGTGAATTCCACTTAGCTATTCGGCCAGGCTGAGTTGCAGACTTCCACCCGTCGAAGCTCGACAAGATCACTAAATAGCAGG
AGGTACCCGCTAAACAGCCTAGAAAGGGAAGAAAAGCAATA