Description :
From Genome Similarity Track
Location :
scaffold_18:484723- 492081
Transcript NameFunction/comments
Plaha_PHALS_05520hypothetical protein%2C variant 1

Sequence
7358 bases(100 bases per row)
TGTGCACCACTCCAAAACCTTACAGGACTGCAGTTGCCGCCATTTTTGTCCTCAAGCGACAAGCCCCGCACCGATTCTCCACTTTAAGTGTTTATTGACC
CCGTGCGAGCCCGCCCTATCATCGCTGTATTCGGCTGAAGTCCATCGCAAGGACATCACCAGTGGCTTTATCTATATAGGTGCGTTGTGTAGCAGTTCTA
GGGGGCAGACACCGTCGTCGCGACCCTACGCGTCCATTTCGCCAAAACCATACCGTGCAATGCTCAAACGTTAAGGCAAATGTTTATTGTGTCTATGCGC
AGTCTAAATGACCGTCATCCAACAGGATCAGACCaccacagtgacacaagtgcCAGTGGATTCTGGCAAGCAGAAGCAAATGGATATTGAACCCGAGGCA
AGTCCGGTTAGCGCTCATGCTAGTGTAGTCATGAATGATCTCAAGCTAGAAGACTTGACAAAGGTTGAGGACAACGAGAAGCGTCGAATTCGCCGCAAAA
GCTCAAAAAAGGTTACGTACGTGGAGGAGGACGACATGTCAGAGGTCGAAGAAGCTATTATCGCCGACAGAAAGAAGCGTGCACAACAACTTGACTACCA
GCTTCGAACTGTACGTAATTTATTGTGTGAAAGGCACACGCTGGAAATCTAATACCTTTTGTCACTAATATAGGATGTGGGTTATCCACAACTGGACCAG
ATTGTTGGACGACGAATAAATGAATCTTCTGGACTCGTAGAGTATTTATGCAAATTTCTTGGTCGCTCGTACTTGCATCTGTACTGGCTAACATTTGATG
AAGTGGAGCTTTTTATACCAGAAGGGTACCAGAAATCTCATCGCGTGCAAGTCTACGATCGTAAGCTGAGGCGAGAAGGATACCAGGCAATGGATGAGGT
TGATGACCTTGAGGCAAATAAACTGACGGTGGAGAAAATTCTGAATCACAAGGTGGATCCAGCCGATCATTTAGACGAACAGATTGAGAAGAGACGCCAT
CAATTACCTTACGTGCCTAGGTTTCCGCGTATGACCAACTATTTCTTCGTGAATAATGCCGACATCATACCGGAGCGTATGTTGGGAATTGTAACGAAAT
TGACGAAAGAAGTTGGAGGCGACATCTTCCAGCACCCGGTCGATGTTGAGGAGGTACCTGACTACCTTAACATTATCATGAATCCGATGGATCTTGGAAC
AATCTCCATGCGAATTGGTCGGGAAAGCTACTACGTTGGACCATCGGCTGTCTCTCTGTTTGCTTCAGATGTGCGGTTAGTTTTTCAGAACTGCAAAGCT
TATAATGCAGAGGGATCCGACATTTGGCGCGTTGCAGACCAGCTTCTACGCACTTTTGAAAAATGGTTGTATGACTGGATACTTTCCCCATCAGCGTGGC
TTCAATTACCTTCTTCTGGGGATGCAGAAAAAGATCAACGTCTTCAGATTGAATTTTGTACCGAAGCtaaatttttttatgatgTCTGGGCGCCTTGGCA
GATTGGCTGCTGTGTTTGTAGAATTAAAGATCATGTTGATCAACTTCTTCTGTGTGACCAATGCGACGGCGAGGCTCATATGCATTGCGCTACTCCGCAG
ATCACGAAATTACCAGAGGATGAATGGTTCTGTGGGTACTGCCGAGCAAGAACAAAATATCACGAAAAGGTAAAAGCGGTGAAGCAACCTAGTACGGATA
AAATGTTTTTATTGGAGAAAAAAGAAGCTATCACGAGTGTTGCTACTTCTGTCTTTGACACCACTGCGATACACGCGGACAAGAAGACAGTCACCTTGAG
CGAGCACGTACCTGATATTTTAATGGAGCGAGCTGATGGTGAAGGTAAAGTAAACAAGAAAACATCCAAACGAATCCTTAAGGGTATAAATGCTACGAAA
AGTTTGGCACCCATCAGCGTGAAAGATCGTGCTGCCACATTTTTTCTTGTTAAGTGGGTCGGTATGTCAGTTCGATTTTCAACGTGGGAGCGCCCTGAGG
ATATTGGTGACGATGAGCAGATTCAAAGGTACTTTAAATTCAGTCGTGTGCCAAGCGCTAAGGAGATTCGTGAGACGACGTGCCAATTGCCATGCTGCTT
GAAGCGACACCAATATGCGCTCGCAACGAGTACAAGTGGAAGTCGATGTTGTGAAAAGGACTGTTTTTGTACGCTCGGTCATGGCCATGAGGGCGTGTGC
AGTCGTAGTAGAAAAATTATGGGAGGGACTTACGGTAGCAAGACCTATCAACAACTTCACATGCAAGAACAAGTCAAGGCACAATTATTTGCTTTTCATT
GTCTGCTGAATAATCACACGCCCGACAGGGATGTGCTTAAGCAATGCGGTATGTATACGAGTGCGTTTGTAATCACAATGCAGTACTTGGCACCCAGAGC
TCTGAAAGAGGATGACGATGAAGATTATTCCGATGGAGATGGGGACTCATCTGATGACGATGCTGACTTTGATGCAATGAATGATTACCTAAATCGACCA
GCTTTCTATCCTGGAATCCTAACTTTGGAGAATGACGAGGACGGCAGCGATGGTGAAAGTGGAGGTCACAGAAAACGGCTAGAAGAAGAAGTCGGTGAGG
TGCTCAGCTCTATCGTTGAACATGTTGCTCTCGGTTACCCTACCGAGCTTGAGAGAATCAAAGCTGAATTTGGTTTTAACTCGACGTacccagcaactgc
ttttaaTGAGCTTCCAGCTTTCACAGAATATTGCGTTAATTTAGTTCGATCACCGTTTGGTTTAGGCATGCGTCTTGGaatcagcagcaacaacaacgTT
TCGGTTCTAGGATTTCAGATTCTTGCAAATGGAATGGTAGGCCCCGCTCAGGCCTCTGGAGCTATATCAGTTGGTGATGTGCTTGTAGCTGTGAACAATT
CATCGGTGGCTGGTCGCTCGTTCCAAGATGTCGTCGGATTGATTAGTGCGTCCTCCAGTCATGTTATTTTCCATTTTCATTCTCCTCGACCAGCATTTAT
GTACCCTCCATACTGTCAAGCAAAGCAAGTCATGAAGACCCAACTTGGTAAGATTCCTGATGATGCAGCACCCTACAACTCTAAGTTTACGAATTACAGT
TACAAGAAGTACAAACGAATGCTCAAGGTGGGTATCGCTGATCCTAATGTGGCATCATCAGCTTCAACGCAGACGTTGATGCAATATACGAATTACATCG
CTCCAAGCGGCCCTATGCAACATCTTTACACAGGAGTAGTCGACAACAGTATCGACCCACATGAGCACTTTGCTAGCTTTCTTCCAGAGCGAAGTATTGC
AAGAACTAAAAAGTCACGCAAAAATACTACGGCTGCAAGCGAGCATGGGGATACGAATGAGTTCGTACCATACGAGCAGTCGCCAACGTACAAGGGTGGA
CGCACGCTGCGTGCTTATCAAGTTGAAGGCCTCAATTGGATGGTGTCCTGTATCAAAGCTCAAAGATCGTGTATTTTGGCGGATGAGATGGGTTTAGGAA
AAACGGTTCAAATAGTCTCACTTATCGAACATATGAAATCAGAGGAGTTGATTCGTGGACCGTACTTGATTGTCGTTCCGCTATCGACGATTCAGCATTG
GCGACGTGAATTTGAGAGCTGGACGGATCTAAATGTGTGCGTTTATCACGATATTGGTGACCGTACCACAAAGTTCACGGCTAAAGATATGCGCGCAATC
ATTCGAGACCAGGAATGGTACTACCCGAGTTTGGGCAATTCCATTTTTAAGTTTCACATCCTACTCACCACTTTTGAGACGATTTTGACCGactttgaag
agttcgaGCACATTCACTGGCGCTTAGTCGTAGTTGATGAAGCGCATCGATTGAAAAGTGCCGGATCACGTGTGCTTAAAATGATGCGCGTTTTACACGT
CGACCGCAAGGTTTTGCTGACGGGTACACCTTTGCAAAACAATACACAGGAGTTATGGGTGCTACTGAATTACTTGGAGCCAGTAAAGTTTGCCAGCTTG
GAGGACTTTAATCGAGATTTTGGGAAATTGTATTCGCAGGAGCAGGTCGTGCGACTTCAGCAACTGCTGGCACCATACATTTTGCGTCGTGTAAAGGAGG
ACGTTGAAAAAAGTATTCCTCCGAAAGAGGAAACAATTATTTCCGTAGAGCTAACGACGCTACAGAAACAGTACTACCGAGCGATATACGACAAGAATAA
GAGCTTTTTGTACCGCGGCACAAAGAACGGGTTGCCGACGCTGAATAATATCCAACTGCAATTGCGAAAATGCTGCAATCATCCATTCTTGATCAAGGGT
GTCGAGGAGCGAGAGCTTGGCGAGCTTGGCAGGAATCCTTCACCATCACAAGTGATGGAGAAAACAATTGAGTGCTCTGGCAAAATGATGCTCGTGTCCA
AACTGATTCCAAAACTCAAACGGGACGGACacaaaattttgatcttTAGTCAATTTTTGAAGCAGCTTGACCTACTTGAGCGGTATTGCGATGCAAACTC
ATTTATTTACGAGCGTTTGGACGGCTCTTCAGGTGGAAGTGTGCGCCAAAGCGCCATTGATCGATTTTCGAGGCCTCACTCGAAgtcttttatttttttg
ttgaGTACGAAAGCTGGTGGTGTGGGTATCAATCTAATTGCAGCTGATACAGTCATCATTTTTGACAGCGACTGGAATCCGATGAACGATTTGCAAGCTC
AATCACGTTGCCACCGAATTGGTCAAAAGAAGAGTGTCCAAGTCTATCGTCTGGTTACCCACAACACGTACGAAAGCGAAATGTTCGACCGTGCTTCACG
AAAACTCGGTCTTGAGCATGCAGTGTTAGGTACGGCGTCATTTAATGAAAACTCTCAGATTACAAAGCCATCGGCAGAGCAGCTTGTCGAATTGCTGAAG
CGCGGAGCGTATGCGTTACGAGAAGACGACGAcacggcttcaagggaattTGCTGAGCGCGACATTGAGACTATCTTGAAGGAAAATGCTCGTGTTATGG
TTGTAGGCGGTGCGTCGAACTCCAACAAAGGCGCAGACGACAAAACGGTTTCGCAGAAAAAGTCTCCATTTAAGTCctcaaaaagaaaatcaCTCGGTGG
TATGGCAGTAGATCGCTCGTCCTTCGTAGCGGATGGCGCGACTGGGGAATTGTCTGTGGATGATCCAAACTTTTGGGAAAAGGTTCTTCCAGGCGCTGTT
TCCGTTGAAATGCTGAGTCTGAAACTCGAAGATGGGAGCGCCGTTAATTCTCGCCaatcaaaaatcaaatttatcAGCAATTTAGACATTGCTTTAACGA
GCTTGGTCACTGAAATGAGTTCAGGCATTAATGCAGACGAAAGTCGCGTCGGAAGTAGAGACATTCAGCATGAATACGATATTGCTATCCAGGTACTAAA
TACCGTGAGCTCAAAGTATCGCGGTGAATTCTCCAATGACCAAATTGATCTCGTGAAAGgatatttgacaaaattgGAAAGATCACGCGTGCGAAGCTGT
CGATTGGCTCCATCTCGACCGAACTTGTTCCAGGATGAGGAGTTTGGTACACCAAGGAAAAAACGTAGGAGAAGAATTCTTACAGCTGAAAGCAGTGAAG
ATGAACCGTATGGTGATGCCCCTTTAAAGAAAAGAAGAACTAAACGACGTGGTCGTCCGCCAAAACATCTGCGAAATGAAGAACCAGCTCCACCCATTCC
ACTGATCCAAGGCGGCATTTTAAATGAAAGCGACGATTTGTGCACTCTTTGTGGTGACGGAGGATTGATACTGCTATGTGATGGCCCATGTCATCGCTCC
TTTCATCTTGAGTGTGTGGGTATGAAAGACGAGCCGAACGACGAACAATGGCTGTGTCCAGATTGCTCTGAGGGTCGTCACATGTGCTTGATTTGCAAAC
AGGTCGGTGAAATGGGGGTGGAGTTTGGTGTCACACAATGCTCGGTGGCAAAGTGTGGTCGTTTTTACCATAAAGGCTGCCTAGCAGAGAACCCATGGGT
AGAGTGGGTTGGCAAGAAACGATTTCGTTGCCCGAGTCACTACTGCCATGCCTGTTCAAAACCCACTAATTTGCGAGCAAAAGCTAAGAACAAAGCGACA
AGTAATAATAAGGGTGGCGTTGTAAGCTGTATTCACTGCTCCCAATCCTTCCATCCCGAGTGCATTCCATCGGTGGACAAATTTATACGTCTGTCAAGGA
ATCTTTTGCTTTGCGCCAATCATCTGGACGGAAAAAAATCACTTGCTCCAGTAGTGAGGAAAAGTAAATCTCAACGCGCAGGTGCAGCGCTTGTCACGGG
AGAAGCTCAGCAGCGACTAGAAGTTCCAAAAATTATCCCTTTCGATGACGGCAACGTGGAGCAACCAGAAAAAAGGAGCAGCAAGAGGAAGCGCACATCA
CAAGCAAAAAGTTTCAGCTTGTTTGTGTCGAAAAAGAGCAACACTACGAGTTCAGCAGTAAAAGTGAAGGTCTGCGCACTCTGCCACTGTGAAAGTGTGA
TGGAACGAGGTGATAGTGTTCACGATCTGGCATCTGCACCCAATGTAAAAAAAGTAGCAGACTCTACCAAAGCAAATATGGCTGTGGTGGGGCCGTTTAT
TGAGGCCCCTGTTCGCTTAAAATATTCGGACAGACCTAATGAATTGGTGTATGTTCACTTGAATTGCGCTGTACACTCACCCGAAGTGTATGTAAAGGCC
GACGGTCTGATTATGAACTTGCCGAAAGCTGTAAAGCGAGGAAGGCAGCTTAAGTGTACCAGTTGTCATCAATTCGGTGCCACAGTTGGCTGCATTGTAA
CCAAGTGTCGGCGCAACTATCACCTGCGTTGCGCCTTGGAAAGTGGTGGTAAAATCGACAGCTCTACATACGCATTAAAATGCAAGCCACATGCTACTGC
GCACCAGGAACCTACTCGAGTGTGCGTGTGCAATTCTAATGAGGACGATTCAAAGCTTACAATGAGGTGCTCTTCCTGTTCCGCAAAGTATCATCCCAAG
TGTGTCAACATGTCGGAGCGTCAAGCGTCTCGCATAGCAAAAACGTGGGTCTGCAGCATGTGCGATGGATCTGCTGCTGCAAAACCAGCTACTTCAATAC
ATATGGTCACCAAATCAGCAGTGAAGAAACAATTGCCGAAGAGCAAGCTAAAGATTGAAGACGGAGCGGCACTTCAAAGGAGCAATCCAAGTACTGAAAG
TGCCGCAACCGCGACATCGAAGCGCAAGAAGCCGAAGCGAAATCGCTTGAGCATGCCACGGAACAAATCATGTCTTAAGTCAACCGGGGCAGGCCATGGT
ATTTCGCCGCATATGGACGCTAACTGGGACAGCGGCGAGTAGGTTGAAAgaaaaaaga