Description :
From Genome Similarity Track
Location :
Scaffold_105:48465- 74229
Transcript NameFunction/comments
Phymu_g4419hypothetical protein
Phymu_g4420hypothetical protein
Phymu_g4421hypothetical protein
Phymu_g4422hypothetical protein PHYSODRAFT_308450
Phymu_g4423conserved hypothetical protein
Phymu_g4424sporangia induced hypothetical protein
Phymu_g4425hypothetical protein PHYSODRAFT_553660

Sequence
25764 bases(100 bases per row)
CATGGCATCGGTGCGACGCCTGCTGCTAGCTGGAGGCCACGATGTGGAAAGTGAATCCCTTCGTCATTTACTCCACTCTTACGACTcaaacgctgcagac
gctctCAACCTCGGGCTTCTAAGCACTGACCCTTCTGTTCTGCCGAGCGACAATGAAGAAAGCAGGAACTGCTCGCAGTCTTTATTGGAGGATTTACTAC
TGTATTTGGTTGTTCGCAAGTTTGGAGCTACCGAAGCATCGGCGGCAGGTAAAGAAATTGTGGGAATTGACGCGCATACATTGGCGCGTTGGCGAGACAG
AGGCGCACAACAAACAGCAGAAAGCGGTGACCTCGTGGAGAGTTTGTGTGGGTAAGATAAACAGTTTTTATGACCCAAAATCGTTAAATTTTCTAGAGAC
TGTAACTTTGCTACTGTATGTGCAGGCTCCTGCTGAAGACTGAGTGGGGTGCTTCTGGTGTCCACGCACTTAGTCGAGTCGTTAAGCGTCTGCAAGATCC
TCGAGCTCGTCAACGTTTTCTATTGTTTGCCTTTCAGATACTTGGGAAATTACCGCAGCCAGAAGTTGATACAAAGTTGTTCGACGAAGCGACTCGTCTG
TTGTTACTTGGAGTAACAGATCTGTGGTCAGCAATCCGGAAAGATAGCGCCAAGTCTGCAACTGTTATTGTGTTTGGGTTTTCGTCACAAAGCCATATTG
AGCAATTCATGGACAGTTTACTCTGTGTCGCAATCGGCTCTCGGAGTGTCAGCGCTGATAAAAGCCAAGTGACTGCGTGGACTGAGAGAGAAGGCGCTTT
ATTAGCGCTCTCAGTTCTTTTACACTCCATCAGAAGGGAAAACATCACTGAAGAAATCCCAGAGCCCAAGATTTCTCAGGTGAAGAACGACATCAAAGGA
ATGTTGGGGGTCCGTCCATTAACAGGAAGATATTACCTTGGATCGAATGGAAAGCACACTTCGACTCAACTGCCACGCTGCCTAGTACAGACCCTAAAGC
CGGTGATGTATCAGTGTCTCCgtcacgagcagctcagTGTTCGAGAGCTGGCTGCTGAGTGTTTGGCGGTGTACGTTTCTCTCTGTGAAGAACCGACTCG
ACTTTTGATTTTCCAGGAAGTTATCAGTAAACTGAATCGGATGAATCGGAGCGAGAACCTCGGTGAGATCGATACTGGAGCGAATCCAGAGGAAtcagag
ctgctggatgcgttCGAAGCTGAAGGTTTGCTGGACGTGTTGGCTCGAATGGCTCCGTGTCTGCCTTCAAACTTCCTGCTAAAACATTGGAAAGTTATTT
ATCCGACGCTGGAAAAATACGTCATGCACATCGCATCAAGCGTTCggcagaagagcagcagtgtaGTGCGCGCACTGGCCAGTCGGAACCTGAGAGATGA
AGCGTCcttggagcttctcgtgCAAATGTTAACTTCACTATCCAAGCAGTTACTGGACGAAAGCAGTCTCTGTTGGCAAAGAAAAGAAGGTCGTCTATTG
AGCGTCGACGTCCTCATTAACGTCCTTGGGGAAAGTCTACTGGAACGTCAAAGAGCTGTCTATAAGACGGTGAAAGGGACGGCAGAGTCTGTAGAATCTC
CACAACGCAGATCCAGTGCACTTGCCGACTTGCAGACTTTTAAGTGGGCTCATGAGCATGCTCAGGCCACGTGGGTGTTAGATGAAAAGCAAGAATCCGG
CGGCCTGGGTGAGTCCCTTGTCGAAGCTATCAATGCATGGACGGAGACAAACAATGGTAAAAATGGTTTACAAACCTCAGCTTCTGCCTTCTGGCAGCTG
GCCCTGGGTGGGTGCATTGcgcagacgaaggaggcATTCGATTCCTCTCAATTTGAACTTCGCCGAATCTCTCGCCAAGTTGTTCCTGGTCTAATGAGGC
TAATCATCTGGACTGACCAACTTGATTTCTTCTCGTCTGCAGCATTTGAAGCGGAATCAAAGACGTCGTGGCCCTGGACGTGTGTGAAGTACATTGTGCT
ACATCTGCGCTACTTGGAAGAGAGTCAGAGCACTTTGAGTGAAAATGTAGCTCATAAATTGACAACGAATTGGAAATGTGTGTGGAATGGCATCACCACG
CTGGAAAGTAAAATACCGAATGTCGATACGGAGACTATTGTGACcaaagtggaagtggaagtgacGGCATTTCTTGCGTTTGGAGCGACAGTGGAGCCAC
CCAGTCAAGTCAGTCGCTTGTTGGATAATGCGTTGATCTCtatccaccagcacctcccTAAATCAATGCAGCTCCAATCCCTAAAAGTGGCTGGAAGTGA
CAATTCTCTCGACCGGCAGTTTTGTGTCTTCCTTGTGCCTGTGCTTCCGGTTGTTATAGCTACACTGCAATGCCTGAATGGATTCACTGATATGAGTAAA
TTGGACTTGTcacctgcttctcgatggcTATTTCTCGAGCGAATAGTGGTGGCCTGGCTGCTGTGCGACGATATGTTCCGGTGGATAACTCTCAGTAAAA
CAACAGCTCAGAATCAGCTGTTGGAGAGCCTCAggctgcttcttcgagttCCAACAATTCATTTGtcccaagcagaagaaagcgaagagaTGAACAGAAT
TTTTAATTGTCTTCGCGACATTGATGCTCTTTTGCAGTCCAAAATGAAAGACACGACGTACACTTCGTTGCTGGACGTTTACTTGAGGATTTGGCTACGA
GGCATCAAATGCAGCCAAGACACTGGGAGTATAGCCACTTCAATCGCTCAATTGTACAGTGAGCGACAGCAACATGTTGCCAAGAAGGAAGGAAACAATT
CGTCATGTCTGGCTACAGATACATGGGACGAAtgggatgaagaagatcaagtcCTGCCAGCAACTCCAGTGGTTAAACTACAAGGGCCTTCAGCAGATCT
CCTGTTTCAAGACGTGCTGAGATCTTTTGGTGCTGATGAGCGAAGCCTGTTACGCGAGGCAGCACGAGGAATCCCAGCTCTAACCGGAAATATTCACGTT
ATTCAAATGCTGCAACAGATCGAGCAGGTGTAGGAACATGAACATTGGTGGAGCGTACTGTATATTCCATGCTTGTTCCTTTCCTCTTTTATCTACTGGA
CCAGACTCAATTCCACTATTACAGAGTATTCGGTATCTTGCAGTATCCAAGTCTGTCTTGGGTAAAGATTTTCTGTTGTTTCTTACGCTTTTAAATACGT
CGAAATTCGTCGATACGCCCCAATCACAGTACCTCGCTCTTGAGTAAGTTGACCATGTTGATAGCTGCATTCACATCTCTGTCCCAGAAGAgagcgctgc
agttcgcgtGCTCACAGCACAAAACTCCGTAGCATTTCTTAATTCCACCAAGTTCCACAGATGCGCAAGAACTAAAAACACGACAAACGCTACCAATACG
CTGTCCCAAGTGGCTACTTCGTGCATCATCCCCTTCATCCTTCGCCAAAATGTCGTGGTAGTTCCCTCTGCCTTGTAATTTCGTAGCACTTCAGGTACAC
TTGTcagttcttcatcatcggaAATGCTCCGTTCCGGCTCGTTGTCTCTCGTAGCTTGCACAGTGAAGTAATTGTTGATAATCTGCTTCGACAGcgaagc
ttcgtcgtcagGCAGCAGAATTGTCGTGCCCAGAGCTTGATCCGTCATGGCAAATATCGGTTTTACGCGTTAATGCCTCGAGTTCTGCTGGTCGTAAGCC
GTCAGTGGCAATTCCAAACCGTCGCGACTTGAAGGTTTGCTTCAAGATACTTTTTCTCTCCTTGAAGCAATCGTACTTATGGGTAAAACCGCAACTCGCG
TCCCGTTTCTCGCGGATGGAGGGgaccgaagctgcttctcgacgcaCGTTCCGCTTCGTGTGTGGATCTCGTAACGATGACATTGTGTCTAAACGCGTGA
CAGAGCCGACACTAAAGCGCCAGCGTGTGGGTACACCTTGGATCGTCCGcgtggaactggaggagctcattTGCTCCATTGACGAGGCCAACGAGGACAA
CGACAAGCATTACGGACTGTTCGTGTGGCCTTCTGCGCTGCTTTTGGCTCGGTTTGTCGCTCGAGAGGCTACTTGTCTCTGTCGTGGTAAAGTTCTGCTG
GAATTGGGCTGTGGCACAGGACTCCCGTCGATTCTCGCTGGCTTGTGTGAGGCTACAAAAGTTTACCTCACGGATAGAGCCGATGCGACCGACGTTCAGC
TCAATGCAGAAGCCAATATCAAGTTGAATGGGCTGCAAGATCATGCTGAGTTCCTTCCGCTTGTATGGGGCGACATGTTCGTCTCAAACGAGCTCCTATC
CGTCTTCCAGACTGTTGAAGTCGTCCTCGCGGCCGACTGCTTCTACCAATCTGAAGGTTCGTCCATTATTCGGTTTTAACTATTTAATCGTGCTAAAATC
TATGTGTGTGAGTAGATTTCGAGAAGGTGATCGCGACTGTCGCTCTCATTTTccgctgcagtggctccacTTCGTGCaagttcgtcttctcctATCAATT
ACGCAGTATCAACCGATCGATCGCTCCGATACTGTCTCGCTGGGGGTTAGCAACTAAAATACTTGACAAAAGCGATCTCTTCGACGACGTAGATGGCTCT
CAAGACTTTGATAGCATCTTTCTCTACGAGGTAAAGCCTCAGAAATGACAAAATGTATAGAAATGGATGGCTCAGCTTCGCCTTTTATCTTCTGACTCTC
ACAGTGCATTTGCAGTGTTTCTCCAAGTACTGGAGAATGTCCCTCCCATGATCTAGAGAGCGTGTGCGTGGGGCTCTCGCAGcagcctcttcagccttTC
AATGGGAGCTGTAAACTGTCGCTATTCCCTGACAGAGCGAATGCCTTCGCACGAGTGAGACCGTGGAGCTTCCTATCCACTCGCTAGAGGTCGCTATACA
AATACAACAGGGATTCGTTCTCACAGACACTCGAGAGTTGAGGATTTCTATCATCCTCGCCACCAGTCAATGCAAAAAACAAATGTACTTAGTACCTCAA
ACAAGAATTTCTCTTTACCTCACCTTCTAGAAAATATGCCTCGACTATGTGTCcttctgattggtcaaaataGTACGTATGTGGCTGGTGGCACAGTCAC
CGCACAACTCAAATCTTCCAGGAAGCGCATCATGTTAGCCCGTGTCGCTCGCGTTGCTACGCTCTCGGCCGTCCGCCGCACGCCCTCCGTGGCGCTGCGT
GCGCTGCAGACCCGTGAGAAGTCATCGCTCGCCTCTATGCTCAACGTACGTCGCCAGTTGCCTGTAAAACTCACTGCGAAAGGAGTGTATCTCAGCTAAA
TTTTACACTAAATTTTATTGCAGCGCGAGAtccaggaggagaaggccaactGCTTCGAGGAACCGGAGCTAGAGGACCTGCGACTTAAGGTGGAGCAGGT
gttcaagctggaggaggccCCTGGATGCATGGACATCCTTCTGCAGGGCACTGTGGGTGACGACTCGATCAAGATCAAGTTCAACGCCCAGGACAccgtg
gagctcgaggaggaagaggagtACGAgggagacgacgaagaggaaagCGAGGAGtatgaagaggaagacgaagaggaggaggacgagctcccTGGCGTCC
GCTTCACGGCCGACATCACCCGCGAGAACAAGGGTCTTCAGTTCGACTgtgtggccagcagcaacctcACGGTGGAGCGCGTGCGCTATCTGAGCGACTT
CGCCAAGGAGGCCGAGGACGAGACGCTGTACTTTGGCCCCAACTTCATCGATCTGGAATTGGACGTGCAGGACAAATTCTACAGCTACTTGGCCGACCgc
aagatcgacgacgagctggcCCAGTTCATCACGCAGTTCGCGGACCTCAAGGAACAGCGCGAGTACTTGGGCTTCCTCGAGGATGCTGAGACCTTCGTCA
AAAACTAAACAACAAGGCAGTAGCGTGTTGTCGATACAGGTTTGAGGCCTTTGACCCCACACACAATAAAACAGTTAGAGCCTCACTCACCACTTGGCAT
TTACACTCCTTGATCGCTAACGCTTTCCTGTCTAAAGCTTAACCCTGCATCCGAGCCATCACATTCTGCATGAGCTGCGAGACCTTGGGGTTCGACATGT
GGCGCATAGCGGCGGACGGGCCCTCGCTATCCACATCACGGAAGAAGTCGGCCAAGTCCGGGTCCGAACGCGCTGCCATGAGCTCTGGGCTGTTCATGAG
ACCGCTCATGTCAGGCATGCCACTTCccgctcctccagcaccagctcctccagctccagcaccagctcctccagcaccaccgagGCCTCCCATGAGGTTG
CTCATCATGTCGGGGTTCTGCATCATATTCTGCGCCATCTGCATCATCTGCGGGTTCTGCATCATGTTCTGAGCCATCTGCATCATTTGTGGATTGTTCA
TGAGGTCAGCAaggccgccgccgccaccacccAGCATACTAGCGAGATTCGACAGGTCCGGCAtgcctccagcaccaccggcaggagcagaagcagaagc
actAGGCGTCGTCTGCACCTGACGGCGTTTCCGCTCAGCATCCGCGAGTCCGTCGCGGCACGCAgcgttgttgctgtccacCTCAAGCCCACGGCGGAAG
GTGTCAATAGCACCGTCAAAGTCCTTCAGCTGCACCTGAGCACTGCCCATACGGGAGTAAGCCTTCACGTACGACGGCTTAAGAGCGATCGACTGCTCGC
AGTGTTCAATCACATCCGTGTACTTGCCCAAGTACGTCAACGCCGCGGCCAAATTTGAGTGGTAAATGTGGGACGAAGGTCCGTCCGGCGACAGCTGCAG
AGCCTCACGGTAAAGTttagcagctccttcataGTCCTGACCACTGAGTGCAGCGTTACCCTGagccttcatctcctctgCCTTggcctgcttctcctcc
tcagtcAGCTCCGGCTTGACATCTCCGAATTTCTCCTTAAATTTAGCAAGAGCTTTGTTCGTACGCGTGGCATGTTCAGCAGTTCCAGGTGCAGCGTCCT
TGAAGAATCCCTTGCTCTCGAGCTTGGCCACCCACTTCTTCCACAACTCCGGGTCTGTCATTAACAAGGAATTGATCAGATTCTAGCTGAAATATACCGG
TAATATAACATCAATCATAGCATACGCTTCATGACAACGGGGTCCTCGTCCGCCAACGACTTCTCCCCGGGTGTACCCGTCTCCAGGTTCAACGCCTTGA
GCCCAGCAGCGAAAATCTCCTCGAACGAAGCATCTCCGCTCACTGCCAGCTGTCGCTTCTGTTCCGAGTCACGCACATCAACGCCAAATGCCTCGCTGGT
AAAGATTCATTAGGGTATATGGAACGATTTGAACAGCTTCTACTACGAATTATAGCGTGCAACTTACGTGAGGCGAGAGAGCGCAGCGTCGACATCTTGA
GTATTCACCCCGTCGCGCGTCTTGAGTGCGTCTACCCACGCCAGCGCATTGAACAGCGTCGCCTTGCTGCCCTCGTCCATTTTGCTTTACAGGCAATCAA
ATTCTCCCCTGTTCTCGAATCCACACAcaatttcagccaatcatagGTCGCTGTATTGGAAAGATCAAAACTCCCAAATGGATGGCTTTTATCACAACAT
GTAATtttccagccaatcagaggCTGCCCACCATTTCGAAAAGatcggagctcttcaacatagatggctacattaaATGTTTTAcaatggaggaggaggc
tgcgaATGAGGCAGCACTTCTGGAGCGACGTCACGAGCTCCGCAACAGTCTCAGAGCTGTAGAAAACTCTCTaagagaagctggagcggTCACGAATGGG
TACGACAGCGCGTATCTGCTGGAGTCTTCTAATTCCGAGCTGCCTCCTACGCTATTCCGTCGACATGCTGTGCATATACCTGAGGCGACTTTTGCtcgat
ctgcagcttttcgctTTGATTTTGACACACCTGACACAGCTCGGTACGAGTGGAGACTGTCGCCGTTGGGTGAAGCCAAATGCCGACGGATTTGGGACCT
TTTCGATGCAGATAAAGACGAAACGTGGACACACAGCGAGTTCCTCGAGTATATGGCAGCGTTACAATGCGATTCAGTCGAGTTAAAGGCGTTTGAAGAC
AGTGCTGAAGTCTGGGGAATGTATATGAGTGACATGTGCGAGCTGGATGAGGAAGGGAAGCTGACGTTTCATGGGTTTAAGCTCTACAGAGAGCTGATCG
AGGACGAACAACCGTTGATACGTGATTTAAGAGCGTTAGGTATTTCGTTGGAGTGGGAAGATCTGCAAagaatggagaagatcaagcagcttttcgatGA
GTATCTGGACGATCCGACGGGCAACGTGACTGCGAAGGCAGCGCAGTATCTGCTGGCTGAAATTGGCTTTGTGTTGACGAGTGAGGAGACGACAGAGATC
ATTGAGAGGCGATATCAACATGCACGATGCCAGCGGTTTATTCATCAACTTAAGCGCACGTTGAGATTATTCGGATACCGACAGAAATCCACTCTGCGGT
TCACGAATGAAGGTTTTCCAAAGAGTGGAGACAATGAGGAGCAGCCTCGAATCTGTAAGGTTGGGCTGCTGAGCctcgtcttctcgtcctggtgTCCAGC
TACAAAAACTGTAAGGGCCAGTCAAGTACTTTGCCTACATGCACATGTGTATTTACTGACTGAGTTTCGTTTGCAGCGCTGGCGTCAATTCTTTTTGAGG
TGGAGATTGCGGTCTTTTTGTGCTTTGAGGCGGCTTAGGCGTCAAGTTCACTTGGCTTTCGAATGTGTGAGGCAAATATCAGCCACTGGGATGTTATCGG
CAAACTGCCTGCGGTCTGAAAACGACCGAGGGGACTATATGCTGAAACTGGACGTTGGTCCGAAGTTCTCAACGACTTCTACCATTCACGTCACTTACAA
CGCAGAAGCGGACTGTAAGTAAAGTATATCTGTAGTTCAAACAAGTATCTAACCAACTTTTTATTCAACttagctgctgctactcTTCATGAGCTGAAAT
ATCTCGAACGTGGCGCAGAATGCTTCCTTTACGTCGATTTGACCTGTAGAAGTGGCACAAAAGGTTGGTAACTTTTGTTTATTAGCGTAGTAGTTTTAAC
AGCTCTTAAACTATTCTACTGCAGATAGCGATGCACATGTTCTGGTGGACAAATTGACCTGGTTCCTTGGAGAATACTTCCGTGATCACATCGAGTCGCT
ACCTTTTTTTCACCGCTGGTTCTTCACGACCCcgaccaagcagcaacttcgtATGGGGCCACAAAGCGGAACTGGGGCTCCGTCACTAGTTATTCGTCTT
GTGATCCTGTTCACAGGCGGAATGGACCTATACCACGTGATGCAGAGTCTCGGTCTACCGTCGTCCATGCAGTTTgaccaccttctccagcgcttttCCT
TCCGTTGTCTGTGCAGTCACTCACTGGAAGATCTAATGGTGATGAAGAGCCTTAACCTTGGAGCGCAATGGTCTTGCCGAACTCAACTGGATGTGCGGCT
CAATCGACAAGCGTGGGCTCAAATTGTCTCCCAAGTAGCGCACCACCTCAACACAAAGTTGACGCATGAACGGGAGGATGAGGAGTTCGTCGCGCAGATA
GAAGCCGAGcgagagcagaagaagaagatggcgaatCAGCGACCGTCAGTATCAGCTCGACTCGGCGATAACCAGAGTGAGGAAGCTTCAGAACATCCTC
CACTTGGTAAAGCCGAAAGCCGCCAGCTGCTGATCAATTCACTTCGTCGAGTggctcgagctcttcaacactcccagcagctcagctCCACATTGTCCTT
CGCGAACTTGAGCTCTGCTCTTCGTGAGAATCCGTGGTTTCGAAGCGTACTTTCACCTGAATGGTATGAGTTATTGAAGTACGTTCTCGACACTCCTGGT
GGGCTGGCTACTGAGTGGAAAGCGAAAGGAGACTCGTTACGTGCGGAGTTCGCTGAGACTCCGTACGCCATGGCTGGAACTCGACATCATCCAACGTCTC
GAATGACCGAAGAATTCTCGCTTGACGCGTTGTCTGCAGGTAAAACCCTATCGACAGGACGATCGGAGGCGCCAAAGCTTACAACGAGACGTAGTCACAT
CCAATACGAACCGAAGCTTACGGCTAGGCCCAGCCACACCCAACATGAGCCAAAGTTAACTGCGCGTCCTGGACAGGAACAGAGCCAAAATGCCACGAAT
CTTCCCGAATCGACCGAGGAAAAGAGCACCGAGTATTTACTGCTGGAATTGTACGACTTGTGTGCTCGACACCTACAAGGAGTTCACGTTGTGCGTGCTG
AGGCCGGGACGAGTGGCGTCACGTGCGTCCTCGACGGTTGGCACTTGTTCAGTTTGCTACCGAGGATTCACCAGGGACAACTGGCCAAAAGAGTTTCGCT
GCTTCGGTCGGGGGTGTTCTCATCGCGACAGTCTCTTTCTAGCAGAAGCCTCAATCCAGGCACGGGGATCTAGTGGCGTTAAAAATGCACAATACCTTTA
TCACTTTTTTTTGTAGTAGATCGGATAAACTTCGTCTCAACAGAACTACCCATCCACAAGGCAGTTGGTCCTGCCCTGGCATCCAGTAACCAAGGTTCAC
AATTTCGTCACCTCTACCTTACCCAATCTGAACCGGGACGCACACAACAactacagtactacatgCAGCACACAGAATTTACTTTGATAGGCGGATGGTC
AGTGTAACTATGACAAAGTGTAATGCTCacagaaggaggaggcgccAAAACGGGCCTCGCAGCTTTCACAAAGTAACAAATAGATATCTTCACTCCATCG
CCACGCTATAGATTACTACAGTTCAATACACAGGATACAGCAGCCAAAGAGAGGAGTTCCTCGTCCTTGGAGGCAAATTCGACACTGAACAAAGCAAAGA
GGCAGCGGCGTTTGACTGGtcagcaagagctggagTAAAATGGTGATATAGTGTGTACAGATGGTGGCCACATTGAACTGTTGTCACAAAATCATATATT
TTGAAATTTGACCAATCGATGTAAAGCGTAAACTCAATTTATGACTTTTTGTCATGGTGGATCGGCTTCAAGTGCAGGACGTCGGAGTGTCTGTCGAGGC
TCCTACACACGCCAAGTCCGGGACCCAAGGTGGTGACTATCAGTGTATCGCAGTCTGCCACACGACCCGCGTAATTGCGATCGCAAACGGCCGTTTTGTT
GATATATACGGCGCCAGTGGCAACAGTTTACATCCTTTCGCGTTCCTGCACCAGATTGCCATCGCAGACCACGTCGCTCATCCGCAAGGATCCCTATCAA
GTAAAATCAACTCCCCAGAGTTGAATAAAGTTGTGGCAACGAGTGTGGCGTTCCCTGTCCCCGGTTTTCTGCTGGTCGGGGTATTCGTGGAAGTTCTGGA
ATCTGAAATTTCGGGAACTGATGGTATCGAGAACCCGACAAGAGATGCATTGCTACTTGGGTTCCGGTTGTATGCTGGATCTGTGACTCGATGCATGGCC
ACTGCAGACGGCGATAAACAGGGTCAAGTTCCAGCGTCTATTCAAGTTTACTTCAGTTTTGTGGAGCCGATTTCGGATGTTAATGTGAAGAGCATTCGCT
ATTTGCAGAGTTTTTGTGATGGCATGACGCCAGATGCAGGGTCAGTGCTGATTCTCTTCGACGATTCTACAATGTTTGGAGCGTTGACCTGGAAAGAGCG
GTTTAGTGATCGACATATTTGTCTGGCGCAGATAAAGCAACAATCGGAGAAGTGTGTAGTTGCTGGAATCAGTCCTGATGGGCAGTATCTTGTACTTGGA
GACGCAGGAGGACGGCTGTCTCTGATAAGCTTCAAAGATTTTCTCAAGAATGAGAATGATATTTCTACGAGACCCCGGAAAGGTGTGAAAGGCAAACGAC
TCCAGCTTGGAGCATGCTTTAGTTCGGGAGTGAAGGTGCGCGATAGCCCGTTGGAACACGTCCGCCTTATTCATACTTTAGTGACCTCAAGTGTGGATTG
TGCATATACAAGTCTTCGGTGGTGGACCTGCGGTGTCCAAGATCTGCAGAAACAGTTCGTGCTTGCTGGCAAGCAAGATGGGTCGTTAAGTGTACGTAGT
TGTTGCGACAACTCAAGACCTGTGAAATTAACCTGTTGTTTCTGTCTGGTACAGGTATTCAAAGTCTCTAAAAGCAACTCTACAATCGAGCTAAAGCTGG
TCCAGGTATGTTCAATTAAATTGAATTGCTTCAATGTCTCGTAAATTTATAGCCATTATTTTCCTATGCTCTGCTACTGTAGATATATCCAGGCCTAGCA
TCGGGGACGCATGACGGTGTCCGAAGTATTTCGAAGCCCTTGAAAACTGGAAAGAAGCCGACTCATAACACTTGGTTCGAGTTTTGCCTACTATCGGAAA
TGCGCTGGAGGGTTTGGCGCGTACAAGTTATAGAAATTGGCGAAGAGCATTCAAAACGACATCGTGTGATTTGGCCGTCTGTGAGGGACTCACTGGACTT
CCCGTCATTTACAGTACGTTTGTTAATCCAAACCGTAACTCTCACAAGTGATTGACAAGTCTTGTACGCTTAGAATCCACTCAGAGCAGTCACAGGATCG
GTTCTGCTTCCAACCTGCACGGAGTTTTCGAAACCCATTGCCGAAGCTTTATCGATCGCAAGTCCAGACCATACCAGTGAATTCCCTATTGTTTTACTTG
TAGCTGTCAATCGTCTACAACTTGTTGGCCTGCTAACGAAAGCTGTGGTCGAGATCACCGAGGTGTCGTCGGAGTCTGAAAGCATTAGAAATCCACACGA
CAACAGCAATAGTGGGGACGTAagtgaacatgaagaagctcagcaagaaTCGGTCGACATTGCCACGACCGATAGGAGCAGTGAAGAGCGGAATACCTCT
GGGCCTACAACTATCCAAGACAAGTACAAGCTTCCTCCGATGGAGTGGAAGACCAGATATTCTGCATTTCGTGATGAACAGCTTTCCAAAGAACAGAACG
AAATTTCATCCAAACCTACGCGAAGGTCAAAAGTCACCCGGGAAGACTACGATGAGCGAGTCACTTCCGCCATGCAGCGCGTTGACAACTTAAGCGGCGT
CATGAAATCGATGCGGACGTCTTTCCAATTGTTTTCCAGCGACGTCCGGCAGCACCTGAATCTCGTTTCGGATCAACTGGAGGAATTGGGTCGACGAGTC
GCACGAgaaactgcttcaacgtctcgAATTGACCCACCGGGGAGGACCTTAGATCATGGAGAAGAGCTACCTCCAAACGCAGGCGGAAATCACTCGCTTC
AATGCTGGAGCGAGGCCTCTTGAAAGTGATAACCAGACCCCTTCGCCTGTGATTCCTCACGTGGCCGACAAGTACGATCCTGATCATCCCGATGCTGACT
GGGGAGGCTACGTGCGTCGTTCGTACAAAAAGCGCTTCTACACGGATCAATCTGGAGTTAAAGACGTACTTCTGATATTTATTTTCTTGTTCTGTGGTCA
TCTTGATCCATTGACGTTATTCATTTTTGCTGTTTAGAGTCTAACTTACGATGAGAAAGGTGGGATTATGCCCCGTGAAGCGCCAGAAAGCTCGACGACA
TCAGGGAAGAAACTCTTTGATCCTCAACAGAATTCAACCGGCGAACAAGTTCCGGGGATTCCGTTCCAAAGTGCTGTGTACCAGGTAAAGACAGTGTTTT
AGAATTTTATTTTCTAAAGGATCAACGTTTCATATTTGCTGTTTGCAGGTTGGACCTGGCAACGATGTTAGCTGTAGCGACTGGAAAACGTAAGTAAATG
CCCACCAAGATGTTCAAAGTTTTGTCCAAGTCCTGACACTTTCTCCAAGGTCGTATGCCTCACAAACGTCAATGGAAGCTACGCCAAAAGACAATTTCGT
ACTTGGAACACGGCAGAACGCACAACCCAAACGCCACGTGACGCCTATGGTACTACACCATGCTCGTGTGATCACACTTCCCTTGTGCTAACACTGCGTG
GTTGGTTCTCAGTACGAACAAGGGCGTGGATCCCGTCAAAACTTGGCTCGAACTCAATCACCTTCCACCCTGTGCGAACACAGACAAGGGTCACCGTCGC
TCGGTggaagtggcagcagcggATCGCTTTCTGGTCGACGTATCGACTCGCGTCGCTCCCTCCTCGCGGGTATCGGCAAGTTGGTTGCAGCAGAGGATGT
CGGACTACGCCCGTAAGTTGTGTTGCTCGAAAGAATCCCTTTGAAAAATCCTTACAAGCGTATTCCATAGACCACAAGAACTTCATCTATCCGAAAGCTA
CACAAACCCTGCATCCAAGACGCTCCTAGCAGAGAACTAGTGAGTAAATTCTGTACGTTATGCGTGAAAGTAAGCTAACGTTCCTTTTTGTCAGCCACGG
GTCCACAGTGGGGTATACTGGACGTCGAACCTTGTACTGACACTAGGAAAAGTCAAAACAAGTGAATTGATTCTTGAGCTTTCATCCGTACCAGTCTGCT
TTACATCGAGTGCATGTCAATTTGTAGCAAGCAGAGACTAATCAACGCGCCTAGGAGCGACAGCGCGCCGCCCACAAACACCGGCAGAGCATATCCCAGC
GACGTCTCCAcgagtgcagcaccaaccaAGAAATTCAGCAGCTGCCCGACGCAATTGGCCGAATTCACGGCACCAACATACATTCCGACTTGAGCTGAAG
TCCCGAAGACGTGGATGATGATAGGGACGATAAGTGCGAAGATTGTGGCCTGTGTGATGGCAGTGAGGGCGACGATTGTCACGTCCACAGCAACGACCTT
CATGAACGCCATGACCATCAGCAACGCCTGCGGGATGCACGCAACAGTGACGACCCAGCGAGCGCCCAGACGGTACACCAAGAACGGCAGCACCCACGAG
TACAAGTACCCGATCACGTTGAAAAGCAAATCCGCGAGTCCACCAGCGATCTGAACGCCATCGTTGTAGCGCTTTTGATCTTCAGTACAATGATTTGGGG
CGCAAACGTCCGCATCCGTCGAGTTCCCACCGAAGACTTCAATGCCGAAGAACTGGCCTTTGTTGCCATTGTAAGCTGTAAAGCCGAACTCAATGCAAAA
GAACACCAGACAGTAGACCACCAGCGTGCGAggaagcgtcttcaagccGTGGAAAATGGACGCGAACGCTTCGCCAATCCGGTTCAAAGCGCTgggagct
tcttcatccggCCCCACCTCTAAGTTCTTCGACGTCTGAGCCTCCTCCGTAGCAAACACGCACACAGCTCCCACCGACGCTAACATCGTCACAGAGAGCA
TTCCCAGGAACCAACGCAACGTTAAATGGGCTGCACCGAAGATGTAGATGTAGCCTGCCACCCAGATCGAGCCTAGCGTTGAGCTGGCCTGTCCGATGCT
GGCCCCCAACGTCTGTCGATCGCCTGCGAAGTCGGCGATGATGAGGAAAGCCGGTGTTTGTACCACATTCACCGTGACGTCCATCCACGTGTAGAACAGA
ATCGTGAGCCAAGCAGTCCAAGAGCGATTATCACCCGAgtcgccaagcagctccccCAACTCCCGCGTGAATCCCATCAGTGTCCAGCATGCGGCACTTG
TTACAGCTCCATACACCAAGAACGGCCGGCGACGCCCCCACTTGCTCTGGCTGCGATCGCTCAGAACGCCAATTGTCGGTGCCACGAGAATACCGGAGAG
TGGACCGATCAGCTGAGTGAGCTGTACTGCGAACGGCGGCAGCATCGTGCCGAGGTACGGACCAAGCGCAGCCCATTGAGCGGACCAAGCCATGTTAGTG
GCCATCCGAGGTAAAgaaagcagcacgagcatgCCCACAGAGCAGCCAACAGCATGCTTCCCCTCACCAGAGTCGTTGAGGTCAAGGTGAGAAAACGTCG
ACAGTCTTGGAGGATGTTCAGGCAGTCccaaagcagcagagccTCGACGCGGAGGTGACTCGGACGGGTTGTACGTTGGGGTAGTTACTTCAATGTGCGC
GGTCATGAGAGCTTGGGCCGCAAATTCGCAAATGAGGACTGGCAACGTGGCTGACATGTTCAAGTTCAAGACCCCAGTTCGTCTTGTTATCAGATTCTCC
TCCCTCGTTCTCAGCGCAATTCATTCATCTTTGTCCTGCTTAGTCCAACCACGAACTACGGTTGTCACTCTTGCGTGCTCCTACACCACCACAGGCTTCG
AATCTCCACACTGCAATGCGCGTATCAAAGGAGAATAAAAGCGTTGAGAATGCAGCTTAAGCTGTAGCGTTAGACTTGTTCGATCGATCTCGAGTCTCCT
GCATCGCCTGCCGCATGCGTTCCTTCGCTTGTTCTTTCAGGTTCTGGAAAAACGCGATATCATCccgcagctccaccagcagttCATGGTTCATGCCGTG
CATCTGAACCTCGTGGAACGTCTTCCGTAAATCCTGCAGAAtgtccagcacttctttCAAGTGGCGAGTGTCTCGATCGCGTTGCTCGTCCATCCGTTGC
cactcctgcagcttcatcttggttTTGCCCAGTCGAATGGACTCCATCAACTGATCCGTGACGACCGTTCTACAATTGCCGCACAGTTGTCCATCAGCTC
CCGTGCTCTGGGTGTAAGAATTGGCGATTCCGCTCAAAATCTCCAAGTCTGTGGTCGGATTATTGCTCGTTGTAGTCGAAGGTTTCCCCACATTTGGCGA
TGGATACTGCATAGGCATCACCGAGACCAGACTGGGCTGACCCCCGTCGTAGAATCCCTGTAATTCAGTACCCCCAGTGTTGTTCCCAGTGTCCGTCTGA
GTCTGCATGGCCATGGTGGGGAGTTTCCTCTTATTAGTCATACTGTTGATAATCTGGACTTCATTCTCTCCGTTGCTGACGCTttcgtcgtcctcggtcT
CGATATCACCACGCTTGGACATTCGATGACCATTATTACTATTCGGGGGTCCTGGAGTTATTGTGCCGTCAAATTTGCGCAATAATTCGATGTAGCCCCC
TTTATTGTCATTCGCCCCTGGACCTTTCTTAGTCGGGCGGATGCCGCGTCGGTAGCACTCGGCGCGCAGATCGTGAGCGCGGTGCCGCTCATACGGCTCC
AGTAGACGGCGCGTGGCCTCCTTCCCCACGTCCGCGTCGTTcgagagcagcgagtcgATGTCCCCACCGCTGCTGTGCACGTCTCCAACGAGAGAACTGC
TGGACTCCATTTTGTAATAAAGCCCTTTTGAGAAGAATGCGTAATATGGTCGTATCCAAATCGGACTATTTCATCATACTGAAATCAAGACATTTCAGCC
GTTtctcaagttgaagccgatTTGATCTCAACGGCAAGGATGAGGTGCTTGTGCCCTTGCATCTCCGCTAAATATGGGCGCGAAGGCGTCGTGTCGCCTA
GTAACTCGACTGTCTCGACTGCCGAGCTAAAACGGGGAGTTCTAGCATCGTAGGGATCAGCTGCTGGTCATGTCTGTGGTGTATTTCTGTCGATGATCCA
CTGCTTGCGCCTTTGCCTAACGCCACGCAGTTCTGCTTCATACACGAGCCGAGCGGACGGAATTGCAGAGGATTGAGAAGCCAtggacgctgcagatccG
GCAGTGGAAGTAGCTCGGCTCAAGGGCGAAGTGctcgccaaggaggaggcgctcAATGCCCTCAAGGCCAAGACCAAGGCGTTCGTGGACAACATGCGCA
GCCAATTAGCCagcgagacgaagaaggtcGCGGCACTTGAGGAGAAGTTGAAGGacgccaccactgcagctGTTGCACCGGTGGCCGATAGGTCGGCATG
GACGGAGGAgattgagaagctcaagaaggagacggcagtacgcgagaacgagctcaagacaCGCGCCAAGTCCTTCGCAGACGCCATGAACTCGCAACTG
GAagccgagaaggagaagagccGAGACCTTGAGACTCAGCtacagcagaagacggaagctctcgcagctgcagaagctgcaaaagctgctgctgaccagg
ccaaggagatggaTTTCCTTTCCcaaccagctcctgctgctggatcgcacaccgacgacgagtttaACGCTGTCCAGTCTCAGCTGAACGCAGCCAACTT
CGAGATGGCCGACTTGCGCGAACGTATACGCAgcgtggaagctgaagcttctcAGTCCGTCCAGCAAGCTACGAGTCTTCGTCAGGAACTGGAGGCTTTa
cgagcttctgctgagcagcagcgcagtcagctacaagctgaagttgatACGTTGAAGACTCGTGAGGTCGCTCTTCAGAACGAAATCAGCTCCCAGCAAA
CTCAAGTAAAAGCTGATGATGGCGTTTCCCTCGAGGcggacatggagaagatcaaggagctggagttccagcttgagcagcataAAATCGAGAACCAGCA
CCTTCAGAAACAGCTATCGGACAAGGACTTCCACTTGGAACAACTTGACGGCTACCGACGGCGGGCGGACGACAGTGACTCCAaggttctccagctccag
gccGAGATTTCGTCTCTCCAAAGTCAGTTGCAAACTAAAAGTGACGAACTGACCTCGTATTCATGCGGTAAATGcgctgagctggaggagaagctgacaG
AAATCTCTCAGCTGTATGAGAAGGTCAACTTGGGTAGAAGTCGTAGCGACAGTTTGATCGCCGAGACGCAATCTCAGCTGGGAGAGATGCAGaccatcaa
gcagcagtacgtggCGTCCCAGGAACGGCTCGATgagatgatgaagcagaaccTGACGCTCAACGAGAAGATCtcggagaaggagattgaggtgacgacg
ctcaaggccgaaatgaagaagtggagcaTGGAAATGGCCGAGCTCCAGGCGCAGCACAGCACTCTCAAGTCCGATAGCAGTGAGCACCGCCAGCGTTCGG
AATCGGTCCATGCCGAGTTCCAGAAAAGCGAGGAGACACTcaaagagctgcagacgaagagtacgcagcttgagaagaagaaccaggaGCTGATGGCGTC
GATTGAGACTATCAACAAGGAAAACACGGACAAGCGGCAGAAGGCAAAGGCGCTGGTGCAGTCGCTGGTCAGTGAGAAGACAGGGTTACTGGAGTCAAGA
AGTGCGCTCCAGAAGGAGGTTGATCGACTGCGTATGGAGGTTAACCAGCGCAATGTTGACAATGATCAGCAAGTGAAGCAGCATCGGGAGGAGACGAACG
AGAAGGCTGCTCACAGTGCTGCTACCATCCAGAGTCTCACAGACGAAGTCACTCACCTGAAACACGCTCTCACTACGGTTCAAGAGtcggagaaggtgca
gcagcgagcaaAGGAacttgcagcagccaagcgaGAGATCGAAGACTCCAACAAGAAGCGACTTGCAGCCAAGGCCGAGACGCAGAAACTGGCTgtggag
ttggagaacgTTCACAAGTGTCTTGACCACATCACGACGCATGTGAACGCCAACTGCACGGAGAATATCCAGCAGATCGCTCTTGTTCAGGGTCATGTCA
AGGAAGCTCTCGAGGTTTTGGAGAAGCGAGCGGGTCTAGGCACTCAAAACAAGCAGAAGGCCCCAGAAGACGACACGAGCGAAATCGTTCGGAAGGCAGA
GGCACTGAGAACTGGAGGAGCGCAGACAAACCCGGGAGCAAAGAGACTGGAAGAAAATGTGTCACGTGTCAGTGAGCAGGTAAGACGCAGCCTTAAAGCA
CTTGCTTATCTCCAATAACTAACCGTAACTTGTGTCGACAGATTCGGCAGCTTGTGGACATCACCGAACAGCTGTGTGATATCGCAGTGGAGCAGAACGA
TGCCAACCTGAAGGATGTGATCATCAACAAACTCTCGCAGACATTCACCCAGTGCTTCTCGGATAAACTTCTGGCCGTCTACTCCAAGGCCGACGAGGCT
GTGAGTCTGTTGGATACGCATGGCCCAACTTCAGAGAGCGGTCATGCAGCTGTCCGACCCAGCAGCTAACGTCAAGACGGCAACTCGTAGCTTATAAGCC
AACACCACCAGTATTTGCATCCTTCTATGAACAAACATCAATCCACCACCGTCCACAGAGTAGAATTAGTTACctccgtcgctgctgtcttcttcttcgg
catgCGCGCTATCAATCTCTTCGATGGGTGGAGTACGGCCACCACTCGATCCAGTGTCGTCCTTGGAGTGAAAGAACTGATCAAGCAAATCCGGATACGA
GCGGCACTTCTCTTCCAACACCTGCATCAGCACGTTAGGCTGTTGCTCGGTGTTGCCAGCTTCCTCCGCCTTGGTTTCCTCCGACTTAGCTTCCTCTGAC
TTGGCTTCCTCCTGAGCTTTTGCCTCCTCGGATTCCTTCGACTCCTCGCCCTGAAGCGCTGCTAAGCGTCTGACAATCCCCTTGCTGTGCTCAAGGATCT
CCTCGTGGGCGGAGAGCACACTTCGGcgctcaagagcagcaataAGAACCTCCCCGCTAGCAGCTCCCTCCCCTGCAGGTGGAGGATTTTCCATAGCTGT
ATGTTCCAGCAAGcctacgagcagctcagcaacgtcTTCCCACACGGATGGGAACTTGGAACaagtctgcagcttcgtcaactCCTCACACACTACAAGG
GACAGCAACTGAACCACGACCACATGTGGTCGTAGCGCTAGAGGGTCTTTCATTGTCGATGGTCGCCGGCGGCGGCCAGTAGGAGCATTGGAATTGCTGT
GAACATGGGAATCGTTAGGGTGTCTCAATGAACTGGCGTCGTCGATGGTTGGCAACTGTCGTCGGTAGTACAAGAAGGGGGAGTTtgtttcctcttcatc
atctccgAAGTGCATGGCTCCACCAGAATGTTTCGGGGTAGCGTCGTTCAGCAGGTCAAAACCGACAGGCACCAGACCGTATCGCAGAACATCTAGCCAT
GCCATAGACTTAAACGACTGGTCTGTCCCGGTGTGTTCACGCAGCATGTGCTTCAGACCTTCAATCGCCGCTACGACCAAATCGTTTGAAAGCTCCTGCT
TGATCTGGTTCAGCAACAGGTGCCTGGATACAACAGCCATTCCTCCTAAGAATCGCAAGCGTTCTTCAACGTAATTCGCGGCGTCGGGGCGTAGCGTGTC
AAACATgaaaagaagaaggtcgaTCGGTCGTGACGGTGCCCACGAATCGTGAGGGTCTCGGGTCTTCATCGCAAACATGATCATTTTCGTGTAGCAGTCG
CTAATGAGGATTTCGTTCCCGTCTCCGTTCCAAATTTCCTCAGCTACGAGCCGCTCAAGCAATCCGAAGCCGTGTGAAGCAGCGTGAGGCATTCCAACCG
ACCAGCTGATCAAGTTGCAGATTGTCAGCCAGTCCATACGCGAGTAGTGGAGATTACTCGGCTGCACCAACGCTACGTATCGATTCAACCCGCACATAAT
TGGCGTCAGGAACGGCTGAATCAGCTCGTCATCACCACTTATTTCCATCAAAGCGCCCAGGAAGTTAACCAGGAGCAATCCGTTAGCGTCACCACGCGTA
CGCGTTACCCAAGCGAATAAACCGTTAATCGACTTGTGTAGCAGGAAGCAAGCGTTCTCGTACGTCACTCCGCTTAGGCTGTAGTTGGTGAGTAGCACTG
GCCGCAAAAACTCCAGAATTTGGGTGTAGTGAGCCTCCAACACTGCCGATAttccgtcttcatcttctgcaccgCCATCAAATAGCGATCCACTAAGTGC
GATCACTTGACTCAGCAAATGCTCAAATAGCACACAGCCTCCCTGGCTAAGGGACAGCTTTGTAGCCTTCCTTCGATCTTTTTGAGATTCCTTTTCGTCT
GGACCTCGCAATACCATCAAAATCTCGTCATGCAGCGCCTCGATTACTTCAGCCAGGGCACGTGACGGCAAACTTGCTACATCTTGCATCAGAAATTCGA
GACGGTACGGCTGCAACGTGTTTCGGATCCACAGGTCAGTGCCAAACTCGCCTTTAGGGTCGTGATTAAGATCCGAGGCCTGCTTTGTTCGCATCTTCCC
CTCAATCACAAGGTCTTCTGTGTGCGAAGCTAACTCAGCAGGACTAAGCTGGTACTGCTCGAACCCCGGTGAAAGGTGAGACTTCGTTGGTAGGGTGGAC
CCAGGAGCTGAGCCACCAAGATTGGAATCCAACGCAGATAGCAGCCACGCCACACCGCTAAAAAATCCACCCGCATCTCCATTACCGCCTTCCTGTTCTT
GGGCACTAAGCGCGATCTTCctttccagctcttccttgttCTGGTACACCAAATCAATAAATTCAAGGCGCTCATCGGGTGTCAtaagctccagcttcat
tTCGTTGCTTGGATACAGAATCCGAGATGGTAACACGTGAAACTCTCGTAATCCACTCACGACGTGGAAGAAATGCTTCCATGCGCGACTGTGCAGGGac
aagctgcacgtgctggcgAGTTTaagcacagcagcagtcgcgaCCGGGGCGCTCTGGTTGTCGCAATACACCCAGATACCGTTCTCGCGGCCGTTATATC
CGACAGGATAAATGTCCGACGAAAGCAGTGCCGTGTACTTGCACAAACGGATAAATAGCGAGTTGCAGTGCTCCACTAACGACAAGTGAGATGCCACCGC
TGCACACAGCACGAAACCATTGCAAGCTAGCTGGAGGGCGCTTTTCTGCGGCACGTAGTGCATCTCATAGCTACTGCCAACCGAGAGATCTTCGCCTCGA
GCCGCATCCTTTGCTTGGGAATCCACAACAAATTGCTGAAATACACTGCTGAATGCTCGTACAAAGCTCTGCTGAATCAACTCGAAGATGTGACGGTCGT
ATTGATTGCCTGAAGATGCGTAAAGAGGAACCAGCCCCTCAAAGCGTGTTTGCTGCTCCCATGTTCCGCTTTTGGGTAGAATAGTGGCTCCGTTAGCGGG
ACTAGAGGCACTTTTCGTGAATCGAGCCTGCTTCATCGTTCGCATTGCATCAGGAGCTAATGGCGATGATACGCCTTGGGCAACACCAATGCCACGAGGC
GTGCTTGATGAGCGAAGATGCAACGATGGGTGGTGCACAATCAAACGAGAGTTGCGCGGGTTGCTTTCTGCCTGGTTCAGTAGGTCTTTCCATCGGTCGC
TTGTCACTTCACCATGCTTGCCACCATCTTCAAacgtcttgatctcgtccttCGCAATCAGGTTGTACAACTCCGTTAAAAAGTCCTCAGGCAAATCTAG
ACCTTTCGAAACCTCCTGGCCGTAGTTCTTGTTGTTCTTGATAAAGTCCgtcaacttcatcttcttgtccgaTCGGATATTCGGGTTGTGCAGATCCGTG
TTCAGCATAATCAGACTGAACGACAGCAAATACGCCACGTCCACTGATGCCATGAGAAATCGCTCCCGGCACTGTTCGTACACTTGAAGCGAAAAGGTGT
TCAAAATACGGTCAATTTGCTGTGCTTCTCCAGGAAGACGAAAACTTGCGAGGAACATGCGGAGCGCAGCAACAATACTTTCGCCTTCAAAGTTGAATGA
TCGCACGAAATTGGTAAGGACATCACGATGAAAATCCATAGAATCGGCTTCGTGGATCTCTGTTTTCTCAAACCCCTTAACTTCCTTGCCCATAGCGCCC
AAGTAGACACCCACCGCATTTTTGTTCAAACCTTGAGGGAGCGATCGCAAGAATGTTGCCAGCGACACGCTGTCAAGCGGTGTAGGAAGGAAGGAGTTCT
GCTGTAAGTACTTGATTCCTGCCAGCGGCTTCCTATTGAACTCCTGAATGCCATGCTGGAAAAACTTTTTGCGTTGTCGCTTTTTGAACAGAACTTCAGC
TGAAGCAAAttcttcagcatctgcagGTGGAGTCTGGTCTTCCTGATCTATCAACAGTCCATCCGCATTGATTTCCTCGTCGCTTGGTCCATTGCTGCTA
TCACCGCCAACAACAGGCGCTTCAGGATGTGTACGAAGGTGCACAACGTACAGAGCATTGAACATTCCACGGAGAGCGATTTCTCCAACAGCCTGAGCCC
ACAGAAAATGCGTTTCTTCGTGCGACTCAAAGCAAGCAACATGAGATTGCTGTGCAACTTGtgacagcagctcgaatAAAGTCTGCGTCAAGTCGCAGCG
GTTGCCATCACAGTCGTAATTCACGTATAAGTCGGGCAGCAGCGTAGCCTCCGCGAGCAAGTCCACCAAGCAGTCGAGAATTTCAAATGAAATGTTGTAC
AGGCGGCTCTTGGATAGCATCTCCCCAGAGAATTCGTCAAGTGCGGCATCGACCGTTGTAACAGATTTTTCATCTGCCTGGCCATTTGCACTACCGGTAT
TTGGAGTAGCATCGTCACCACGGGGAAACTCTGGGTTGTTTATATCCATATTTGCCAGACACCAGTGCAAGGTGTGATAAAATACGCCGTTAAAGAGAGC
TTCCACCTGCATCTTAAGCTCCGAACGGAGCTTTGACCACAATAGCCGAATCAGCTCGAGGCAAACAACCGGGACCTTCAGCTCCGCACAGGCACTACAC
ATTACCAGAAAAAAAGTAAGCTATCAGATTAAAAAGAAATATCAGACAAGCAGGACATACCCGAGACGGCAGTAGCGCAAAATGGCGCTGCACAGGTCGT
CTTTGATGAAAAGCATCAGCGAAGGCACACCCGTAATCAACTCTGCATCACAAGCCATCagcgcgcgctgcagcaaggTAAATGAAAGCAGCACTTCGCG
TCGACTCGTCGTGTTCCCACTCGGCGTGGCAGGTGCGTCAGGAGCGGGAGGTGGAACATAATTCTTCTGGTGCAGCTTTTGGCAGAGAAACCCCACAATT
TTGACAGCACAAGGCAGTCCGAATCCAGGTCTGAGAGGCTCCGACGAGGACGTTGTAGGTTCTACAGCAGGCGCCAAGTCCGAATAGATCGCAGAATTTG
AGAAAATGAACGCCACAGTGTCATGCAGAAAGTTCGTTGCCGTCGATCGCAACGGCAGCGTGATATGTGGCTGTACAAACACACAACAGATTCATTAGCA
TTCAGCAACTAATCCATGCAAAACTGCAATAGATTAACCACGTACGTCGTGTCGGTTGCCGCGACTGAGAGCGTAGAGCGATTCCACCAACTGCCACATT
GAGTGGTCCGACAGTCTGGATCCGCAAGGCGAGCGCACCACTGCGTGAAGCACGTGTACGACCAGCACCAGTACGTTCTGGTCGCTCTCGATGCCTGTTT
CCTGGAAGCGACAGTGGCTTACAGCGTCTACAATATCCGAAACGGCATCAGCGGCAGCATTTTGGTCCTTCACGTCCGCCCAGGGCCAGGAATGCAGGAA
ATTCATCACCGACTGAAGTGCTGCACCAGTTACAGTACTACTTGCGTGTTCGTGGCGAATCACATCCAGGAATGGCTTCACAACATTCACAGGCGATATT
TCCGCCATATCTAATCCACAACATGTCGAAAAGGGTTATCAATGGGCCTTCAAACGAGAATTAGGCACTTCAACATACTGTCGCATCGTAGCAGACGTCC
ACGGAGTAGAGAGAAGCTCTGAAAGACCACTAAGGGACTCTCCTGCAGCCGTAATCGAACATTTAATGAGCGGACATGATTCAAATTTAGCCACGTATTA
CGCAGCCAATATAACCCTTACACACCTGCTTCGAGCGCGGGTTGCTCGTCCCGGACAGCAAGTAGCCATGACGCCGTCTCGCGAGACTCAGCACGCTCTG
GATGTCGCTCAGCAGGACAGAACGCACCGCCGCCATCTCGGTGAAAGGGGGCTCTCTATTGAGA