Description :
From Genome Similarity Track
Location :
Scaffold_5:484646- 488631
Transcript NameFunction/comments
Phyci_300171Hypothetical protein
Phyci_76671glycose transferase group 1 domain protein, partial
Phyci_89724conserved unknown protein

Sequence
3985 bases(100 bases per row)
ATGGTCGACTCGGGTGATGAGGACACGTCCGCCGCGGCGTCCACGAGCTGGCGCTATTGCCTACACATCGCCTACTACGGCACGGGCTTCGTGGGGTGGC
AACGGCAGCAGCAGGAGGCCAAAAGCAGCTCGGGTCACGACAGCGTGCAGGAGGTGGTGGAGAAGGCCGTGACGGAGACTTTGGGCGCACCCCAGCGAGT
CAACGTCACAGGCGTCAGTCGCACGGACGCAGGCACCCACGCGCTCTATGTATGTGGCTCAAGAGGGCAAACGGGGGATTGTCGGGGGCGTCAGAGCGCA
TTTGAACTAAAGGGTGTCTGCAAAATGTGCATTTGCAGCAATATGGCTTCATTCGACTCGACTCGGAGCTGCACATGACCATGGAAGAACTGAAAGACCA
CGTCAATGCCAAGTGAGTAGCACTAAATCCTGGCCCCTATGCTGTGCTGTAGGTTGAGAGCGGGGGACTGACTTGTGTGTGCTAGATTGGGAAGTGGCCG
AGTTGTGGTGCTTGGTGTGACGGTGCCGACGACGGGCCCGGCGCGGATTCGATCGCGATACAAGAAGTACATCTACTATCTGCAGCAAGGGCATCGTCCC
GATTTGGATCTGGGCAAGTACTCGTGGTTCCTTGGAAGGCGACTTGACATCCAGCGAATCCGTGATGCGCTTAAGTGAGTTGAAAGGATGTGTGAGTAGT
TCGATTGCCGACCACGATGATTTCTCACGAGCTGTGATTGTTACGTGTGGTAGGCATTTGGAGGGTACACACGACTTCCGACCGTTTTCCCAGGGACTCT
TGAAGCCGAAATTTGAAGATTTGACAACTTTGAGGACGATTATATCGGCCAAGGTTGTTGTCCGACGGTCGGTGGCTCTTTGTTCATGCCTGTGTTCTTT
GCACGTGTAGGAAATACTGAAGTCGTGCTCGTGGTGGTGGATAGGAATGTGAACTTCTCGCTAGATCCGCAAGTGTGCGGCAGTGGCGATGTTATTGATG
CTGCAGACATGTACAAAGACCCTCCAAGTGATGCTTCTGCCGAAGCTCACAACTCGGACGGCACCAAGGCTGTGGCAACAGGCGAGCACAAGAAACGGAA
GATCGAGCAAGCAAAAGGAGGAGCGCCTGTGCACTTCGTTTGTATTGAGCTTGTTGCCAATGGCTTCCTTCGGCACATGGTACGACGGATTATTGGAACT
TTGCGTCCGATTGGAGAAGGCACCCAGCCACCTTCTCGGATGCAGCAGGTGCTAGCGGGCGAAGTCCAGCCTGGTCCTTCTGCACCTACAAAAGCGCTGT
GGCTGCACCGTACTTGGCTCACACAAGAAGAGTACGATGCAGACTGTGCTGCGGAAAAGTAGACTGCATTATCAAGTTACAAATAGCAGCAACAAGATAC
TCCTTGCCAGCAACACTCCATTTATTTCGTGGCCATCAAACTCTATAGCTCTTCATGCGCCCCTGCAGCTTCAGCGGTCTCTTCCTGTGCCTCAATGTGC
TGCAAGATTCGAGTAATGTGACCCAGAACAATATCTCCAATGATTTCCGGCGAATATTTGGCCACCATGTCCTCTCGAGCTTGCTTGCCCTTGGCAACAG
CTTCCTGCAAACGAAAAATGGGTAAGCAGAGTATTACCGTAACTTTAGACCGTGCGAGACTTACCTCTGGATGCTCCTTCACACGAATCAGTAACTCCTT
GAGATGCTTCACAGAGGGGTCAGCCCACATGTGACCACGGAAAGCGCCTTCTGTGATCTGCTCAATCGGCCATAAGAATCTGTTAGACAATAATCCCTGG
TATCAGGGAAACCACAGCAGAACGCTTACCTCGATAAGCCCATCGATCTTGAGCGGGTACGAATTTTCCTCCGTCATATATTCAGTGGTGCCGCTCCAGA
AGGTAGCGATCACGGGACGCTCCATAGCCATGGCCTCGACGTGCGGCCGGCCCCACCCTTCTCCACGCGACGGAAGGACAAACGCATTGGCCGCCTTGTA
CAGCGAAGGCATAGCCTCTTGGGGGATATGAGGCGGCAGCACGTGAACGTGCGGCAGCTCATTCAGCGGTTTGTCCACTGCTTCCGACGCGAACTTCTCA
ATCAGGCTCTGGAAATCCCCAGCCGACGACGACGACGTGTGATAACCGTTCGTAAGCAGCACAAGCACAACGTCGTCCTCAGCCGAGAAAGCCTCGAAGT
ACGCCGTGAGCAGCACTTTCCACGCCTTGCGCTCCTCCCACTTGAAAATGGACAGGTACACGGTCGACTTGTCCGTCATCTCGAACGCCGTCTCAGCCGC
CAGATCGTACACTTGCTCCACCTTGTCCGGGTCGAAGAAGTCGACGTCCACGACTTCAGGCACGACCTTGACGGCTTCGGGCCTCACTCCGCCGTCCACG
AACACCTTCTCCTGGAACTTGGTGGGCACCCAGATCTCGTCCATCTTGTTCATCCTGTCGGGCCAGCCGCTGGGCACTCGGTCCGTCTCGAACATGGTGC
GGCCGACCTTGTACTGCGCCTGCTCGGGCGGGCACCGGGACGTCATGTAGTGCGCGGGCTCCCAGGCACCCGGCTCCGAGTGGCAGATGGCCAGCGCGAC
CTTCCTGTTCTTGAGCCGCCAGTAGAAGTCCCGCTCCTCGATCCAGTGCTGCTCCAGCTTGGAGCGCATGTCCTCGGGCAGGTCTCGGATGAAAGACGGG
TTCAGCGAGTCCCCGTGCTGCGTGATCAGCAGCTCAAAGGGCGGCTCCAATGTTGCGTCGCTGTCTGCGTCTCGGTCGGCCTCTGGCACCTCCTGGCTGC
CTGAATGCGACGGAGATACGCTCGACTGTCCCAGTGCAGCGTCCAGTGCCACGACGTACGAGTGCGCTTCGCTGCAGTAGCCGCCGCCGCTGAGGAAAGG
GGCGTACCAGAGCACGGCCGGGGGTCCGGACTCGCTGGTCACGGAGGCGCGGCGGCCGAAAGCGGCGGCGGGCGGCGCTAGCAGCGCCCAGAGCGCGGGG
ACCAGCAGCGCCACCTTCATGATACAATTGTGACAGTAAGGATCGAATTTTCGCAGTAGAATTTCCTCAACTTGAACAGGACCATTTTCGCATTTGGAAT
AAGTTTCTCATTTGGAATAAGTTGCTGCCTCTCCTCAAGCTCGCGCTGGTGTGTGTGTGTGTGTTAGCTGCGTATAGCGTTAAGAACGACTGCGTTTGTT
GTTTTTGTTGCTGCTGGTGCTCTACTACCGACGGGGTGGCATTAGGACGCGTACTGCTTGGTCCACTCCTGCGCCGTCTTCTCGAAGTCCGCCTTGTTCT
CGTGCATCTGCTTGGCGATCTCAGGTTCCAGCGGGTTGTCCATGTCGGGCTGCTCCAGGATCTGCTTGATGGCCGTCAGGCAGTGCAGCACGTTGAGCGT
CGGCCCCCAGTTCTGGCAGCAGCCGAGTCAGCAAAACATAAAAGTCAGCCACACACACACACACCCTCTCGACACCCGAAGAGAACCAAAGTCTCACCTC
GTTGATGATATCGGCGCAGATCTCGCCGGACTGCGACTTGACGTTGGGGTGGTACACGCGCGTGAGGAAGCGCACCTTGGGCGCCTTGAACGGGTACTCG
CTGGGGAACTGCAGGTCCAAGTTGAAGACGCCCCCGGAGTACGGCGAGTCCTCCTGCCACAGCGAATAACAAGCGCTCGAGTCAGCCCCAGCTGCCACCA
CAGCTGCGTCGTCGTCTGCAACGTACGGGGCCTGCGAGCATGGCGTTCCAGTGCATGAGGTCGTCGTCCACGGCGCTGACGGTGCACCACTCGGGCGAGT
TCTTCTCGAACTCGGCGAGCTCCTGCGCAGGAACCGTTAGGTGAGGAGGGAGACTGGGAGAGCAGTGCATTGCGGACATACTTTAGTCAGACGGCGGGCC
ATTGTGCGAGGGGGGAGGAGAGAGAGCAGGGAGGAGGAGGAGGGTGAGTGTCGCTGGTCGCTTGTCGCGCGCGATGCCAATCGAG