Description :
From Genome Similarity Track
Location :
Scaffold_163:4844- 8396
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.14Phospholipid-transporting ATPase

Sequence
3552 bases(100 bases per row)
CAAGTCAAGAGCGAGTACCGCATCGTGCACGTCAGCGATGCCGCGCGCAACACGGAGCTCGGGTACNNNNNNNNNNNNNGCGACAATTTCATCATCACGT
CCAAGTACACGGTCATCTCGTTCCTCCCCAAGTTCCTCTTCGAGAGCTTCCGCAAGCTCGCCAACTTGTACTTTCTTGCGATCTGCATCATGCAGTGCAT
CCCACAGATCAGCAACACGAGTGGCCAGCCGTCGACGCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGTTTGCCATCCTGGAAGACCGAAAG
CGCCATATCGCAGACCAGATCGCCAACTCGCGCCCCACGTATGTACTGGACGCGTCGACCAAGCAATTTGGCTCGAAAAGCTGGGCGAATATCGTCGTCG
GCGACGTCATTCGACTCAACAACCGCGACCTCGTACCGGCAGACATCCTCGTGCTCGCTGTGAGTGAACTCCCAGATGCACCGCCGTCGGGGATCTGCTA
CGTCGAGACCAAATCCCTCGACGGCGAGACCAACATGAAGGTGCGTTCGGCGATGGAGTGCACGCTGGCTGAGATGGGCAGCATCGACAACATCCTTCGA
GCCAAAGGCGTAGTCCGGTGCGAGCAACCGAACAATGCGATTAACAGCTTCCAAGGAGTGTTGGAGCTCGAGGGCAAAGAGAAGCAATCGATCCCGTACG
AAAGCATCATTCTCCGTGGTTGCATCATTCGGAACACGGACTGGGTTCACGGGATTGTCTTGAACACGGGCAAAGACACCAAAATCATGATGAGCAATTC
CGCGCCACCATCCAAGATGAGCACCATGGACCAGTCGATCAACAACTATATCGTCGCATTGCTTGTCATCTTGATCCTCTTCAGCGCCGTCGGAGCCACG
GGCGCCGTCATCTGGAAAAGCACGAACAAGAAACCGTGGTATTTGGCCCTCGATGACTCCGGAAATAGTGCCGGAGTGGACTGGATCATCATGTTATTTT
ACTACATGCTGCTTATGTACCAGTTCGTGCCGATCTCGCTTTGTGTGTCGATGAGCATGGTCAAGTATTTGCAGGCGCAGTTCATCCAATGGGACAAACA
GATATACCACGATACGACCGACACACCGACTCTTGTCCGCTCAATGTCACTAAATGAAGAGTTGGGGCAAATCTCGTACGTGTTTTCCGACAAAACGGGG
ACGTTGACGTGCAACATAATGGAGTTCCGAAAATGCTCCATCGGGGGGGTGTCGTACGGCAAAGGCACGACTGAAATCGGACTGGCGGCAATGAAACGAT
CTGGGAAGCCAATACCGGAATCATCGACATCACAGCAGTCGGCGAAACCAGTTCCATATGTGAATTTCGACGGCCCAGAGCTATTTGCTGATATGAAAGG
CACCTCAGGATCGAATCAACAACGCCGTATCAATGCGTTCTTCACGCATTTAGCTATCTGCCACACCGTGATTCCGGAGCGACGCGAAAACTCGACCGAA
GTCATCCTGTCTGCGTCATCTCCAGATGAGCAAGCGTTGGTTGCTGGGGCTGGCTTCTTCGGGTTTGAATTCATGAACCGCTCGCCTGGGATCGCGCACG
CAAAGATTCAGGGCGTGAACCAGCAATTCGAATTGCTCGATGTCTTGGAGTTCAATAGCACCCGGAAGCGAATGACCATAATCGTACGGCACCCTGATGG
AAAAGTATGCTTGTATACAAAAGGAGCGGACGCCATCATTTTTGCACGCATGGCAAAAACCAAAGACAACGAGGCATCTCAATTGCAAGAGGTCACACGC
CGTCACATCGACGCATACGCAGAGGAAGGGCTTCGCACTCTGACGATCGCGATCCGAGAACTCGATCCAGCATATTACGAAGCGTGGGCACGCCGATTTC
ATGAAGCCCAAAATAACTTGGAAGAGATCGATAAACGGAAAAAGGATCTGCCCAATGCCATCGACGAGTGCATGGATGAAGTTGAAAGTGAACTGGAGCT
TCTTGGCGCCACGGCAATCGAGGATAAGCTTCAGAGTGGTGTCCCGGACACCATCGCGAACTTAGCGAGTGCTGGCGTCAAAATCTGGGTTCTTACGGGC
GACAAGGAGGAAACAGCGATCAACATTGGCTTTGCGTGCCAGTTGCTGACCAATGACATGACGGTCCTTGTGATCAGTGCAAAGCATTTTCCAACCCCAG
AGCTCATTGAAGCAGAACTCTTGTCGCAGATAACAGCCCGCGCTGCAGAAGTACACACGTACTTTGCTTCTCCAATGACGAGCCGAGGGGAGTTAAAGAG
CATCGCTCTGGTCATTGACGGTGAAACCCTGATTCATGCACTGACAGGAGCGTGTCGTCCCCTTCTAGCTGAATTCTCACAGTACTGCAAGGCTGTCATT
GCATGCCGCGTGTCGCCGGCGCAGAAAGCTCAAATGGTTGCGCTCATCAAGGAATACGTTCCGGGTGTTCGCACGCTCGCAATTGGAGACGGCGCGAATG
ATGTGTCGATGATCCAGGAAGCCCATATTGGCGTGGGGATCTCCGGCCAAGAAGGAATGCAGGCAGTCAATTCCAGCGACTACGCGATCGCCCAATTCCG
TTTCCTTGAGCGCTTGCTCTTGGTGCATGGCCGTTGGAACTACCGACGCATGTCACAACTCGTCGTGTACATGTTTTACAAAAACATTTTGTTCACGGCA
GCGCAATACTGGTACACGCTCCTGTGCGGCTTCTCGGGGCAAAAGTTTTTCCTTGAGACAGGTGTGCAGTTGTACAACATCTGCATGACCTCGGTCCCAA
TTGTTGCACTCTCCATTTACGACCAAGACGTGAACGATGAGCTTGCGATGAAGTTTCCAAAGCTCTATTACGTCGGTCCACGAGACGAAGACTTGAACAA
AAGCACTTTCTCCCTCTGGGTCATCGGAGCCATTCTCGAGTCGGTGATCCTGACGCTGTTTGTTCTCAATGGTATGGAAAACGGTGGCTTCCACGGCGGA
ACCAGCTCCATGTGGCTCGACGGCAATATCATTTTCACGCTCGTCGTGCTGATAGCGAATGTAAAGCTGATGCTGTACCAAAACAGCTTCCATATATTCA
ATCATGTGCTGTACTGGGGGTCGTTCTTCATCTGGCTGCTCGTTGCGTTTGTCGCTGGCGAGGTTTCCATGTTGTCGGACCTCACGTGGGAGCTGATGCT
GCAGCAAATGTTCAAGACCAACGCGTTCTGGGTGCTCCTGCTATTCATTCCAGTTGCCACGCTTTCCTACACATACTTGATCAATGGCCTGAAGCTGACG
TTCATGCCCGAGTACTGGCAACTCGCAAAGGAAGTGATCAAATTCAATCTCAGCAAAGATCTCCTGCAATGGGACGACAACACGAACGCATCGGTGCCAG
TCCCCGCCAAACTGAAGCAAGACAAGCACGCGGGACGAGTCGGGCTCGTTGTCCCTACCAACGGCAAGCAAGCGCACAAAAAGACGCCGTTGGAGCGCGT
CTACCACGGGTTCGCATTCTCAACGGACTCGCACGCTGGAGCTGCCGAAGCA