Description :
From Genome Similarity Track
Location :
scaffold_830:4844- 7996
Transcript NameFunction/comments
g10384.t1 ABC transporter ABCA1 lipid exporter family

Sequence
3152 bases(100 bases per row)
GTGGCTGTGAAAGGTCTGGATCTGGTCATGTACAAGGATCAGATCACGTGTCTATTGGGTCATAACGGAGCTGGCAAGTCCACGTTGATCTCGATGCTTA
CGGGAATGGCTGCAGCTTCGAGTGGTGATGCGACGTACCGTGGTCTCTCGTTGAATCAAGACATGGAGGAGATCCGGGAATCGCTTGGAATTTGTTTCCA
GCACGACGTTCTTTTCGACGATCTGACAGTTGAAGAGCATCTTTTGGTCTTCGGACGGGTGAAAGGCTACCGGAATGAAGAGCTTCAGGCTCTTGTGGAC
TCGCAAATCCGTCAGGTTGGACTCACTGAGAAGCGCCACGTTTTATCCAAGGAATTGTCCGGAGGAATGAAGCGGAAGCTCTCTGTAGCCATTTCCCTGC
TTGGAGACAGCTCCCTGGTGTTCCTGGATGAACCGACGTCTGGAATGGACCCTTACAGTCGTCGTAGCACGTGGGAAATCCTCCAGAACAACCGCAACGA
CCGGGTGATGGTCCTTACCACGCACTTCATGGACGAAGCTGATATCCTTGGAGACCGGATCGCTATTATGGCCGAAGGAGAACTGCGTTGCTGTGGGTCG
TCGCTCTTCTTGAAGAACCAGTACGGAGCTGGATACAACTTGACGCTGGTGAAAGACGACGCTAAGTGCGATGATCAAGCTGTGACGAAGCTCATCCGGT
CGTACGTCCCCTCTGCTGAGCTTCTTAGCAACGTCGGCAGTGAAATCGCCTTCCAGTTACCGCAGAAGAGCTCCCCCATGTTCGCTCCTATGTTCACAGA
CATGGACCAGAAGATGACGAAGCTCGGTCTGTTGTCGTACGGGATCTCCGCTACTACGTTGGAAGAGGTTTTCATTAAAGTGGCGGAAGCGGACGACGTC
AACCACCAGCACACACTGGGCCACCAAGAGCGTCCGGACTCTAAAGAACTTGATACTGGCGTGGTGTTGCAGACGACGGGACTGTTCTTCTCGCACTTAA
GAGCACTACTACTCAAGCGTTTCCACCACGCCAAGAGAGAGAAGAAGATGATCATTTACACGACGTTCTACCCGATTTTACTGCTCTTAGCGGGGTTGGT
CATCCTCAAGAGCAGTAACACAACGTCCGATGATCCGAATCTGGTACTGAACACGAACGCCTACAGCTCCGACAACTCGTCGTCCACTCCTTTCGTTTGC
CAAGCGGACGATACCTGGTGCAGTACCGTTCTCGAGTCCTATTTCACCGGTGGGAAGGCGGAACAGCTCTCTATTTCGCCTCCAGCGTACGACGTGAACT
CCCCAACAGTCTTCGACGTACAGTATTCCGACCCAGAGATCAACGCCACGGACGCCACTGGCTTCGAGCTTCGGCTGGGTCAAAATCTGTACAACAGAGG
CTTTGGAGGCAACGATACCGACACGGTGGACGACCAGTACGGCGCCTTCTTGGTCTACGGGGACAGCGACCAGCAGATCTTGGGTTACAACCTGTTCGTG
AACACGACTGCGACCCACGCGCCCGTGATCTTCAAGGCGTTGATGGATCAGGCGGTTTACCGGTTCTTCGCTGCTAATGCGAGTGATTCGGCGTCCAACG
TGGATCTCAAGGTGAACAACCACCCGTTGCCTCTAACGGCCGCTGCGAAGGCTCTATTCGGCTCGTTCCTGGCCTTCAGCGCCTGCATCTTCGTGTGTAT
CTCGTTCTCGTACTTCCCGTTGCCAGTGGTGGTTTACCTGGTGAGGGAGAAGGAAGCGAACCACAACTCGAAGCACCAGCAATTGGTCTCTGGCGTGTCG
CTCACTGCTTTCTGGCTGGCCAATTACATCTGGGACCTCATGATGTACGTCGTCCCGTGCATCGCGGGGATTGTCCTGATTAAACTCTTCGATATCTCGG
CTCTTACCGGTAATTCCGACTGCACGAGCTGTACGTCCGAGACGTTCCCCGCTGTGATGCTGCTGTTCGTGCTCTTCGGATTCGCGATCTGTCCGTTCAC
CTACTGCCTTTCGTTCCTCTTCAAGGAACACGCAGCGTCGCAGACGTTCACGATGAAGATCAACTTCCTCCTCGGCGTTGTGCTCATGATCGTGTCGTAC
ATTCTGGACGTGATTGAGTCGACGAAATCGGTCAACGCAGTGCTGAAGCTCGTCTGGAGACTGTCTCCTCTGTTCGATCTGGGCAACGGCTTGCTCTCTT
TGGTGCTGAATGAGTTGGATTCTTTACAAGACGGTACAACGGAGAAGAAAAGTCCGTTCTCCACGGACCTCATGGGCGCTGAGATGATCTACTTGGTGGT
CGTAACGCTCCTCTTCTCGGCCATTGTGCTTGCGATCGACTACGGTGTCAAGATCCCTGGTTTCCGTCAGAAAAATACCGGTAGTCGAGCTGTCGAGGAC
GGAGACTACACTGTCGACGTAGACGTTGCTAATGAAGCGGATCGGGTGGCCAGTGGAGCAGCAAACAGTGACGCAGTGAAGGTTTCTGGACTGCGGAAGG
TCTACAAGGGTGGGAAAGTGGCCGTCCGTGACTTGTCGTTCGGCTTGAAGCGTGGCGAATGCTTTGGCTTCCTCGGTATCAACGGAGCTGGCAAGACAAC
GACCATGAAGATGCTCACGGGTGACGTACCGCCTACCTCTGGGTCTGCCACTTTAGGTGGCTTTGACATCTTGACCCAACAGATCGAGGTGCGACGTCAA
ATTGGTTACTGCCCGCAGTTCGACGCCCTTTTCGAGCGGATGACGGTACGGGAGCATCTGGAGTTGTTCGCTGCCATTAAAGGAGTGACCCGAGTTGATA
TGGAGCGTGTCGTGACGGAAAAGATTCACCAGATGAACCTCGCAGACTTTGAGCACAAACTGGCGGGCAGTCTCAGTGGCGGTAACAAGCGGAAGCTGTC
GGTTGCCATCGCGTTGATCGGTAGTCCGCCCATTATCTTCCTGGACGAACCATCTACCGGAATGGACCCAGTATCCCGTCGCTTCATGTGGGACGTCATC
GCAGATATCTCCACTCGAGGCAAGGAATCCACGATCGTATTGACTACGCACAGTATGGAGGAGTGCGAGGCCTTGTGCTCGAAAGTGGGGATCATGGTGG
GCGGTCGCCTTCGCTGCTACGGCAGTGTCCAGCATTTGAAGTCCCGGTTCGG