Description :
From Genome Similarity Track
Location :
Scaffold_135:48439- 49824
Transcript NameFunction/comments
Albla_Nc14079790

Sequence
1385 bases(100 bases per row)
CCAGCCCAAGAGTAGAACCTTCACGACCGAGCCCAGACTGCTTGACTCCTCCAAAGGGAGCCTGTACATTGGAAATGAGACCTGTGTTCACACCGACCAT
ACCACATTCCAACGATCTGGAGACTCGCCACACGCGTTTGAGATTCTGGGAGTAAAAGTATCCCGCCAGACCAAATTCTGTCGAGTTGGCCATTCCAACG
ACTTCTTCTTCGGTTTTGAATTTGAACAAAGGAACGACCGGGCCAAATATCTCCTCTGAAGCGATACGCATTTCGGTCGAGATATTCTCAAGAATCGTCG
GGTGATAATAATTCGACCCAAAAGAGGTGGCCGAGCTGCCTCCAATAAGCGCTTTTGCACCTTTGGAAAGTGCATCGCTCACCAATTCAGACGTTTTCTT
CAATGCAGCAGAGCTGATTAAAGGACCCAGCTTTACGCTCGCATCAAGCGGATTTCCCATTTTTAGTTTATTGACCCGCTCGACAAGTTTCTCTGCAAAT
ATATCGTATACGTCTTCTTGCACGAACACGCGATTGCTGCATACACACGTCTGCCCGGTATTTCGAAACTTTGACTGAATGAGACCTTCAATGGCTTGAT
CGAGTTCTGCATCCTCAAAAACGATGAATGGAGCATTTCCACCCAGCTCTAATGAGAGCCGCTTCACATTAGTTGATGATTGCTGCATGAGTAATTTCCC
CACTCGTGTCGACCCTGTGAAGGATAGCTTTCGGATATCATTGTGCGTGGCCAAAACACTACCAACCTCGGCCGCATTCTCATGCGAGGTCGGTAGAATG
TTGAGCACTCCGGAAGGAATACCGACCCCACTAGCGAGTTTGGCTAGAGCCAATGCGGAAAGCGGTGTTTCAGCTGCTGGTTTCACAATAACACAGCAAC
CTGCTGCCAAACCCGGGCCTATTTTCCGTGTGATCATTGCGAGTGGAAAGTTCCATGGAGTAATAATTGCACAAATGCCGACAGGTTCCTTGACGACCAG
CATCTGCTGACCCTTGACTGTGGGTGGAACCATAAATCCGGCCGATCGCATGAGCTCATGTGCGTAAAACTCGATAAATCCAGCAGCATACGCAACCTCC
CCTTCGGATTCTTTGATAGGCTTGCCACATTCCATTGCACAGATTGTTGCGAGATCGCTAGCATTCTCTGTGATGGCTGTAAACCACTTTTTCAGCAAGG
TTGATCGGGTCTATCACGTCGAGTCGGTCAAGCTTGATTTTCTCCGCTAATAAGACTTACAATTGGAGAGGTTTTCTTCCAATTTTCTTGAGCTGCTTTG
GCTGCTTGGATAGCGGCTTCCACTTGCTTTGTACGTGAAGACGCCACACTTGCGATTTCTTTATTGGTAGCCGGATCTGATGACG