Description :
From Genome Similarity Track
Location :
Scaffold_250:48430- 50044
Sequence
1614 bases(100 bases per row)
CCTCTAGTGTTCCTATTCCAGCTGATCTAGCTAAGGCTATCGAAGACGAACTCAAAGCCTTGTCGGGAATTCTAGCTGACTCAGACAGGGATACCTATAT
TCCCACGACACGTCATATCGACAGCCGGGGGTATTAGTGTTCACAGGTAGCGGTCTGTACACGTTGGACAATTTGCACTCACGATACTCACGATACTCAT
GACCAGACCTTACGCACAACGAGATTTCGCAAGGTCCCAACACCGCGTCTGCTACGGTAGCAGCTGCAGCTGTCCCAGAGAGCACGAAACAAATAGTAGT
TAACATATCTGCGATTCGGAAATGGTTCAGCCAGCACAAAACAGTGGCTACACTGCCGGCTACGATGCCAGTTGGTCCAAAGGCTCAAGCCGCGTGGATA
AAACCGTGTGCGTTGGAACTGGCGGCTATTGTCCGCGAGGTGTCGAACCCCTTCGCTAACATCGCTTCGATGCCGGGAGAAACCCTGCGTGCTCGTGGAC
GTATCCTTGATAGCGAGTCTCAACTGGCTGTGATCCGTCAACACACCACACACGCAGATGAAAAAATTTGTGAGTTGTGCTCGAGTTTAGCCGCGACGGA
TGCCGGGCAAACCTATCAAATTCGCTGAAAAACTACTGACAATATTTAACGCTGGATACGACTTAGTAAAGTTCAGCCCGAGTTACTGTGTGCGACTGTC
GTCGAACCGCTGGCGGACTTGGATCAGTAAGGATACCTCAATGTCCTGTATGTATTACTACTTAGATAGCCGCCTTTGAGTATGAGGCGAACGTAGTGAT
GTCGCAGAACAAGGCTGCTGCATACCACCTTTCCAAAGAGGTGCGCACGGCAGTATATAGCATACTTTGCAAACCTGCCAACTGGCATCAGCACCTGACC
TAATCACCTGGATAATCAATATCTCGAACCTCAGTGCTGAGGGCATCTTGGATCCGCTAGTGGCTGGTCATCACGGAGTGCGTTAAACTTTACTCTTTTT
CATATCTTACCGAGCGACCGCGTGCGATCGACATGACTGAGAATTCTCCGGTCAGCTTCAAAAACGGCAGATCTTCCCAACGTCGTCGTAGACTCATGGT
AAAGACTTACCGGCATCCCCGTGAAAGCACCATCCATCTTCATTTGCAGAATGCCACGGGATTCCCAAATCATCCGGAACGCCGTGTAGCATGGTTTATA
CGCTCTTGGCAGCGCGAAGCAAGGGGTTCCATTGACATGTCTCTTTTAAAAGAAACAAGGGTCACTCTGGGTAAGTCAGCAACTATGGAAAAAGATGTAC
AACTCCACCTGGAAATTCGTGGACGAACAGGACGCTCGCTGTCGACATAGTTTGAGAAATCTCGTGGAGGAATGGCTATTTTATTGAGCCCGTACTCATC
GATTACTAAAATAGATCCGTAGCATGAGAAGTATTGAACACCACACTGGAAGGCTCTTAGAACTAAATTTTTGTGCGAATCTGTCCTTTGTTATCAATTT
TTACGCACCAATTGATATGACTGAAAAGGAGGCGTTTTTCGAGGAGCGTTCTAAGAGTGGCTCCAAACTAATAAATTGATCATATATGTATTGTCGAATG
CTAAATTAGCACTT